Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

mouse (Mus musculus) cDNA Library Information

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 325 libraries (by tissue)


   1. NCI_CGAP_BC3
   2. Soares NMGB
   3. Soares NMGBC


   4. NIA Mouse Blastocyst cDNA Library (Long)


   5. NCI_CGAP_BC1
   6. NCI_CGAP_BC2


   9. NIA Mouse Osteoblast cDNA Library (Long 1)
   10. NIA Mouse Osteoblast cDNA Library (Long)
   11. Soares NMBP

bone marrow

   12. Perkins LRH


   13. Barstead MPL-RB9


   14. Barstead MPL-RB12
   15. Life Tech mouse brain (see comment)
   16. Mione mouse WTB
   17. NCI_CGAP_Brn63
   18. NICHD_MM_Hyp1
   19. NIH_BMAP_EF0
   20. NIH_BMAP_EG0
   21. NIH_BMAP_EG0p
   22. NIH_BMAP_EH0
   23. NIH_BMAP_EH0p
   24. NIH_BMAP_EM0
   25. NIH_BMAP_EQ0
   26. NIH_BMAP_ER0
   27. NIH_BMAP_EV0
   28. NIH_BMAP_EW0
   29. NIH_BMAP_EX0
   30. NIH_BMAP_EY0
   31. NIH_BMAP_FA0
   32. NIH_BMAP_FB0
   33. NIH_BMAP_FC0
   34. NIH_BMAP_FD0
   35. NIH_BMAP_FI0
   36. NIH_BMAP_FO0
   37. NIH_BMAP_FP0
   38. NIH_BMAP_FR0
   39. NIH_BMAP_FV0
   40. NIH_BMAP_FW0
   41. NIH_BMAP_FX0
   42. NIH_BMAP_FY0
   43. NIH_BMAP_GH0
   44. NIH_BMAP_GI0
   45. NIH_BMAP_GK0
   46. NIH_BMAP_GL0
   47. NIH_BMAP_GM0
   48. NIH_BMAP_GV0
   49. NIH_MGC_143
   50. NIH_MGC_144
   51. NIH_MGC_377
   52. NIH_MGC_378
   53. NIH_MGC_379
   54. NIH_MGC_380
   55. Soares NMAP
   56. Soares NMBP1
   57. Soares NMBP13-15
   58. Soares NMBP2
   59. Soares NMBPA
   60. Soares NMHy


   61. Yamada 3-W rib cartilage


   62. Barstead MPL-RB6
   63. Barstead MPL-RB7
   64. NCI_CGAP_Co24
   65. Schiller MAC13
   66. Schiller MAC16


   67. Stratagene mouse diaphragm (937303)


   68. Knowles/Solter egg
   69. NIA Mouse Unfertilized Egg cDNA Library (Long 1)
   70. NIA Mouse Unfertilized Egg cDNA Library (Long)


   71. Baker mouse embryo e6.5
   72. Baker mouse embryo e7.5
   73. Beddington embryonic region
   74. Knowles/Solter 11.5 dpc limb bud
   75. Knowles/Solter 2-cell
   76. Knowles/Solter 7.5 dpc primitive streak
   77. Knowles/Solter 8-cell
   78. Knowles/Solter blastocyst
   79. Knowles/Solter E6.5dpc embryo
   80. Knowles/Solter inner cell mass
   81. Ko embryo 11.5dpc
   82. Life Tech 10.5 dpc embryo (10665-016)
   83. Life Tech 13.5 dpc embryo (10666-014)
   84. Life Tech 15.5 dpc embryo (10667-012)
   85. Life Tech 8.5 dpc embryo (10664-019)
   86. NCI_CGAP_Emb3
   87. NIA Mouse 7.5-dpc Whole Embryo cDNA Library (Long)
   88. NIA Mouse 8.5-dpc Whole Embryo cDNA Library (Long)
   89. NIA Mouse E10.5 whole embryo cDNA library (Long)
   90. NIA Mouse E11.5 whole embryo cDNA library (Long)
   91. NIA Mouse E13.5 whole embryo cDNA library (Long)
   92. NIA Mouse E6.5 Whole Embryo cDNA library (Long)
   93. NIA Mouse E9.5 Whole Embryo cDNA Library (Long)
   94. NIA Mouse eight-cell-Embryo cDNA library (Long)
   95. NIA Mouse four-cell-Embryo cDNA library (Long)
   96. NIH_MGC_134
   97. NIH_MGC_136
   98. NIH_MGC_164
   99. NIH_MGC_409
   100. NIH_MGC_410
   101. NIH_MGC_411
   102. NIH_MGC_412
   103. Soares 3NME12.5
   104. Soares NbME13.5-14.5
   105. Soares NMEBA
   106. Soares p3NMF19.5
   107. Stratagene embry. carcinoma/RA (937318)
   108. Stratagene embryonic carcinoma (937317)
   109. Sugano mouse embryo mewa
   110. Yamada E13.5 limb bud
   111. Yamada E13.5 tooth germ
   112. Yamada E8.5 uni-craniofacial

embryonic stem cell

   113. Knowles/Solter ES cell
   114. NIA Mouse Embryonic Stem (ES) cell (Lif+, 48 h, high density) cDNA library (Long)
   115. NIA Mouse Embryonic Stem (ES) cell (Lif-, 48 h, high density) cDNA library (Long)
   116. NIA Mouse Embryonic Stem (ES) cell (Lif-, 48 h, low density) cDNA library (Long)
   117. NIA Mouse ES Cell (LIF-) cDNA Library (Long)
   118. NIA Mouse Undifferentiated Embryonic Stem (ES) Cell cDNA Library (Long 1)
   119. NIA Mouse Undifferentiated ES Cell cDNA Library (Long)
   120. Soares NMES


   121. NIH_BMAP_FZ0
   122. NIH_BMAP_GW0
   123. NIH_BMAP_GZ0
   124. NIH_BMAP_HA0
   125. NIH_BMAP_HB0
   126. NIH_BMAP_HC0
   127. NIH_BMAP_HD0
   128. NIH_BMAP_HE0
   129. NIH_BMAP_HP0
   130. NIH_BMAP_HU0
   131. NIH_BMAP_HV0
   132. NIH_BMAP_HW0
   133. NIH_BMAP_HX0
   134. NIH_BMAP_HY0
   135. NIH_BMAP_HY0p
   136. NIH_BMAP_HZ0
   137. NIH_BMAP_IB0
   138. NIH_MGC_94
   139. Rashbass MOC-10.5
   140. Rashbass MOC-11.5
   141. Rashbass MOV-9.5

Genital Ridge

   142. NIA Mouse 12.5-dpc Male Genital Ridge/Mesonephros cDNA Library (Long)

germ cell

   143. NIA Mouse Embryonic Germ Cell cDNA Library (Long)
   144. NIA Mouse Embryonic Germ Cell cDNA Library (Long, subtracted)


   145. Soares NMUR


   146. NCI_CGAP_SG1
   147. NIH_BMAP_HJ0
   148. NIH_BMAP_HK0
   149. NIH_BMAP_HL0
   150. NIH_BMAP_HN0
   151. NIH_BMAP_HO0
   152. NIH_BMAP_HQ0
   153. NIH_BMAP_HS0


   154. Barstead MPL-RB3
   155. NCI_CGAP_Ht1
   156. NIH_MGC_156
   157. Soares NbMH
   158. Stratagene mouse heart (937316)

inner ear

   159. NIH_MGC_130
   160. Organ of Corti
   161. Soares NMIE


   162. Barstead MPL-RB1
   163. Beier day 0 kidney
   164. Beier day 7 kidney
   165. NCI_CGAP_Ki15
   166. NCI_CGAP_Kid14
   167. NIA Mouse Newborn Kidney cDNA Library (Long 1)
   168. NIA Mouse Newborn Kidney cDNA Library (Long)
   169. NIH_MGC_154
   170. NIH_MGC_176
   171. Stratagene mouse kidney (937315)
   172. Sugano mouse kidney mkia

large intestine

   173. NCI_CGAP_Cec1


   174. NIH_MGC_135


   175. NCI_CGAP_Li10
   176. NCI_CGAP_Li9
   177. NIH_MGC_152
   178. NIH_MGC_153
   179. NIH_MGC_177
   180. Soares NML
   181. Sugano mouse liver mlia


   182. Barstead MPL-RB2
   183. NCI_CGAP_Lu29
   184. NCI_CGAP_Lu30
   185. NCI_CGAP_Lu33
   186. NCI_CGAP_Lu35
   187. NIH_MGC_155
   188. NIH_MGC_413
   189. NIH_MGC_414
   190. NIH_MGC_415
   191. NIH_MGC_416
   192. Stratagene mouse lung (937302)

lymph node

   193. Soares NbMLN


   194. Stratagene mouse macrophage (937306)

mammary gland

   195. NCI_CGAP_Mam1
   196. NCI_CGAP_Mam10
   197. NCI_CGAP_Mam2
   198. NCI_CGAP_Mam3
   199. NCI_CGAP_Mam4
   200. NCI_CGAP_Mam5
   201. NCI_CGAP_Mam6
   202. Soares NbMMG
   203. Soares NMLMG


   204. Soares NKWMD

maxillary process

   205. Soares NMMAX


   206. Stratagene mouse melanoma (937312)


   207. Barstead MPL-RB4
   208. NIH_MGC_178
   209. NIH_MGC_284
   210. NIH_MGC_285
   211. NIH_MGC_389
   212. NIH_MGC_390
   213. NIH_MGC_391
   214. NIH_MGC_392
   215. NIH_MGC_393
   216. NIH_MGC_394
   217. NIH_MGC_395
   218. NIH_MGC_396


   219. NCI_CGAP_SG2


   220. Barstead MPL-RB13
   221. Barstead MPL-RB14
   222. Barstead MPL-RB5
   223. Barstead MPL-RB8
   224. NCI_CGAP_Mu1

nasal process

   225. Soares NMKWNP

olfactory epithelium

   226. NIH_MGC_129
   227. NIH_MGC_399
   228. NIH_MGC_400


   229. Eppig/Hampl oocyte
   230. NIH_MGC_256
   231. NIH_MGC_257


   232. NCI_CGAP_Ov43
   233. NCI_CGAP_Ov44
   234. Soares NMO1
   235. Soares NMO2


   236. Amplified Melton mouse islets 1 MIS1-A
   237. Kaestner ngn3 -/-
   238. Kaestner ngn3 wt
   239. Melton amplified mouse E10.5/12.5 pancreas 1
   240. Melton amplified mouse E16.5 pancreas3 M16S1-A
   241. Melton mouse adult pancreas 1 MAZ1
   242. Melton mouse adult pancreas 2 MAZ2
   243. Melton mouse E10.5/12.5 pancreas
   244. Melton mouse E16.5 pancreas library 2 M16B2
   245. Melton mouse E16.5 pancreas M16Z1
   246. Melton mouse islets MIZ1
   247. Melton mouse newborn pancreas MNZ1
   248. Melton normalized mixed mouse pancreas 1 N1-MMS1
   249. NIH_MGC_137
   250. NIH_MGC_138
   251. NIH_MGC_139
   252. NIH_MGC_140

pituitary gland

   253. NIH_MGC_166
   254. Schiller AtT-20
   255. Schiller AtT-20, RESP18 induced


   256. NIH_MGC_203
   257. NIH_MGC_204
   258. NIH_MGC_222
   259. NIH_MGC_223
   260. Soares 4NbMP13.5-14.5


   261. Soares MPR0
   262. Soares NMPR0


   263. NCI_CGAP_Skn2
   264. Stratagene mouse skin

small intestine

   265. NCI_CGAP_SI1


   266. Barstead MPL-RB10
   267. NCI_CGAP_Sp2
   268. Soares 3NbMS

stem cell

   269. NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit+/Sca-1+) cDNA Library (Long 1)
   270. NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit+/Sca-1+) cDNA Library (Long)
   271. NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit+/Sca-1-) cDNA Library (Long)
   272. NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1+) cDNA Library (Long 1)
   273. NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1+) cDNA Library (Long)
   274. NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1-) cDNA Library (Long)
   275. NIA Mouse Mesenchymal Stem Cell cDNA Library (Long 1)
   276. NIA Mouse Mesenchymal Stem Cell cDNA Library (Long)
   277. NIA Mouse Neural Stem Cell (Differentiated) cDNA Library (Long)
   278. NIA Mouse Neural Stem Cell (Undifferentiated) cDNA Library (Long)
   279. NIA Mouse Trophoblast Stem Cell cDNA Library (Long 1)
   280. NIA Mouse Trophoblast Stem Cell cDNA Library (Long)
   281. NIH_MGC_149
   282. NIH_MGC_150
   283. NIH_MGC_196


   284. NCI_CGAP_St1

synthesized DNA

   285. NIH_MGC_426
   286. NIH_MGC_427
   287. NIH_MGC_436
   288. NIH_MGC_482
   289. NIH_MGC_483
   290. NIH_MGC_484
   291. NIH_MGC_488


   292. Stratagene mouse T-cell (937311)


   293. Barstead MPL-RB11
   294. Barstead MPL-RB15
   295. Barstead MPL-RB16
   296. McCarrey/Eddy 18-20 day sertoli cell
   297. McCarrey/Eddy 18-day leptotene and zygotene spermatocytes
   298. McCarrey/Eddy 18-day preleptotene spermatocytes
   299. McCarrey/Eddy 6-day primitive type A spermatogonia
   300. McCarrey/Eddy adult testis
   301. McCarrey/Eddy round spermatid
   302. McCarrey/Eddy spermatocytes
   303. McCarrey/Eddy type A spermatogonia
   304. McCarrey/Eddy type B spermatogonia
   305. NCI_CGAP_Te1
   306. NIH_MGC_165
   307. NIH_MGC_169
   308. NIH_MGC_381
   309. NIH_MGC_382
   310. NIH_MGC_383
   311. NIH_MGC_384
   312. Stratagene mouse testes


   313. NIH_MGC_385
   314. NIH_MGC_386
   315. NIH_MGC_387
   316. NIH_MGC_388
   317. Ren/Stubbs mouse thymus
   318. Soares 2NbMT


   319. NIH_MGC_189
   320. NIH_MGC_230


   321. NIH_MGC_190
   322. Yamada E19.5 molar


   323. Soares NMTC


   324. NCI_CGAP_Ut8
   325. Soares NMPu


Library ID: 1648
Organism: Mus musculus
Age: 0
Organ: B-cell
Tissue: flow-sorted lymphocytes, marginal zone B-cell tumor
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: mRNA made from flow-sorted lymphocytes, cDNA made by oligo-dT priming. Directionally cloned. Average insert size 1.8 kb. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Note: this is a NCI_CGAP Library.

Soares NMGB

Name: Soares NMGB
Library ID: 1382
Organism: Mus musculus
Age: 0
Organ: B-cell
Tissue: germinal B-cell
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTGGTTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed by Bento Soares and M.Fatima Bonaldo.

Soares NMGBC

Name: Soares NMGBC
Library ID: 1497
Organism: Mus musculus
Age: 0
Organ: B-cell
Tissue: germinal B cell from resting spleen
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGGATTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

NIA Mouse Blastocyst cDNA Library (Long)

Name: NIA Mouse Blastocyst cDNA Library (Long)
Library ID: 1983
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: mixed
Organ: Blastocyst
Tissue: pool of 20 blastocysts
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 20 blastocysts. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 0.2 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC- 3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].


Library ID: 1601
Organism: Mus musculus
Age: 0
Organ: blood
Tissue: flow-sorted, bone marrow progenitors
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from bone marrow progenitors, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1602
Organism: Mus musculus
Age: 0
Organ: blood
Tissue: flow-sorted, bone marrow progenitors
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from bone marrow progenitors, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1689
Organism: Mus musculus
Age: 0
Organ: blood
Tissue: flow sorted, bone marrow stem cells
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from flow-sorted bone marrow stem cells, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1687
Organism: Mus musculus
Age: 0
Organ: blood
Tissue: flow-sorted bone marrow progenitors
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from flow-sorted, bone marrow progenitors, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

NIA Mouse Osteoblast cDNA Library (Long 1)

Name: NIA Mouse Osteoblast cDNA Library (Long 1)
Library ID: 2099
Organism: Mus musculus
Strain: C3H/He
Age: 0
Organ: bone
Tissue: Osteoblast, stage KUSA/A1 cells
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH ( This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 2.1 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.0 kb. The library was constructed by Yulan Piao.

NIA Mouse Osteoblast cDNA Library (Long)

Name: NIA Mouse Osteoblast cDNA Library (Long)
Library ID: 1994
Organism: Mus musculus
Strain: C3H/He
Age: 0
Organ: bone
Tissue: Osteoblast, stage KUSA/A1 cells
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2.1 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

Soares NMBP

Name: Soares NMBP
Library ID: 1441
Organism: Mus musculus
Age: 0
Organ: bone
Tissue: bone pool
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGCCGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo (University of Iowa).

Perkins LRH

Name: Perkins LRH
Library ID: 1472
Organism: Mus musculus
Strain: BALB/c
Gender: female
Age: 0
Stage: adult
Organ: bone marrow
Tissue: primary sorted bone marrow cells
Host: GeneHogs DH10B
Vector: pZL-1
Vector type: plasmid
Insert digest: 5' EagI/SalI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Library amplified by stretch PCR. Subtraction method: Bonaldo, et al., Genome Research 6:791. Library constructed by Dr. Archibald Perkins (Yale University).

Barstead MPL-RB9

Name: Barstead MPL-RB9
Library ID: 564
Organism: Mus musculus
Strain: FVB/N
Age: 0
Stage: adult
Organ: bowel
Tissue: small bowel harvested 72 hours after irradiation with 1400 Gys
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGTCGACATC], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation). Source irradiated bowel harvested 72 hours after irradiation (1400 Gys).

Barstead MPL-RB12

Name: Barstead MPL-RB12
Library ID: 1064
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: brain/CNS
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGGATCCTTC 3' and 5' GAAGGATCCG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Life Tech mouse brain (see comment)

Name: Life Tech mouse brain (see comment)
Library ID: 220
Organism: Mus musculus
Age: 0
Stage: adult
Organ: brain/CNS
Host: DH10B
Vector: pCMV-SPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. pCMV-SPORT2 vector. *COMMENT: Sequence analysis indicates this library is likely to be of rat origin.

Mione mouse WTB

Name: Mione mouse WTB
Library ID: 1437
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pooled forebrains
Host: DH12S
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Size-selected 1.5 kb for average insert size 2 kb. Primary library; non-amplified. This library was constructed by M. Mione (University College London, Dept of Anatomy and Developmental Biology).


Name: NCI_CGAP_Brn63
Library ID: 1633
Organism: Mus musculus
Gender: female
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: brain
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NICHD_MM_Hyp1
Library ID: 2034
Organism: Mus musculus
Strain: C57BL
Gender: both
Age: 0
Stage: mixed
Organ: brain/CNS
Tissue: normal mediobasal and hypothalamus
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5' -ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.08 kb (range 0.73-1.37 kb). 13/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA).


Library ID: 1880
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 0.5-1 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1881
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 2-3 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1882
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 2-3 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1883
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc, containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1884
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 3-4 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1885
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 1-2 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1894
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: GeneHogs DH10B
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 4-5 kb fragments), containing 210,000 recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1896
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: brain, pooled
Host: GeneHogs DH10B
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 3-4 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1910
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 2-3 kb fragments), containing 3.5 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1911
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 3-4 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1925
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 4-5 kb fragments. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1926
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 5-7 kb fragments. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1967
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 0.5-1 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1968
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 1-2 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1969
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 3-4 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1970
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 2-3 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project..


Library ID: 1971
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 4-5 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1972
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 5-7 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1973
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 0.5-1 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains existing tissue from LIB_ID 956). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 1974
Organism: Mus musculus
Strain: C57BL/6
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 2-3 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCAC GACTTTTTTTTTTTTTTTTTT -3')contains the sequence tag CAGCCACGAC between the NotI cloning siteand dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2019
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Organ: brain/CNS
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 0.5-1 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2020
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Organ: brain/CNS
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 3-4 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2021
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Organ: brain/CNS
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 1-2 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2022
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Organ: brain/CNS
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 4-5 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2036
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: whole brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue, adult days 1, 5 and 15 (size selected). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTTT-3')contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Size-selected for the 4-5 kb fraction. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy Project (BMAP).


Library ID: 2035
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Organ: brain/CNS
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 5-7 kb fraction). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2037
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: whole brain, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue, adult days 1, 5 and 15 (size selected). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTTT-3')contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy Project (BMAP).


Library ID: 2070
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue days 1, 5 and 15. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2071
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue days 1, 5 and 15. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2073
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: pooled brain
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse brain tissue days 1, 5 and 15. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Name: NIH_MGC_143
Library ID: 1961
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: brain
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.2-0.5 kb size fraction (other fractions present in NIH_MGC_144). Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library.


Name: NIH_MGC_144
Library ID: 1962
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: brain
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.2-0.5 kb size fraction (other fractions present in NIH_MGC_143). Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library.


Name: NIH_MGC_377
Library ID: 2392
Organism: Mus musculus
Age: 0
Organ: brain/CNS
Tissue: whole brain
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_378 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_378
Library ID: 2393
Organism: Mus musculus
Age: 0
Organ: brain/CNS
Tissue: whole brain
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_377 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_379
Library ID: 2394
Organism: Mus musculus
Age: 0
Organ: brain/CNS
Tissue: whole brain
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_380 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_380
Library ID: 2395
Organism: Mus musculus
Age: 0
Organ: brain/CNS
Tissue: whole brain
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_379 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Soares NMAP

Name: Soares NMAP
Library ID: 1720
Organism: Mus musculus
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: pituitary gland
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCACGCGTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

Soares NMBP1

Name: Soares NMBP1
Library ID: 1683
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pituitary gland
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a NotI- oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGAATAATACATTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacII vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

Soares NMBP13-15

Name: Soares NMBP13-15
Library ID: 1737
Organism: Mus musculus
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: pituitary
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a NotI- oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCTGTACCGATGTTTTTTTTTTTTTTTTTTT-3'; double- stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

Soares NMBP2

Name: Soares NMBP2
Library ID: 1682
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: pituitary gland
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a NotI- oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGGCGCTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacII vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

Soares NMBPA

Name: Soares NMBPA
Library ID: 1738
Organism: Mus musculus
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: pituitary
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGTATCCATGATTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' AND 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

Soares NMHy

Name: Soares NMHy
Library ID: 865
Organism: Mus musculus
Age: 0
Organ: brain/CNS
Tissue: hypothalamus
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCAAGGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Wolfgang Liedtke. Library went through two rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

Yamada 3-W rib cartilage

Name: Yamada 3-W rib cartilage
Library ID: 1322
Organism: Mus musculus
Age: 0
Stage: juvenile
Organ: cartilage
Tissue: rib cartilage
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without

Barstead MPL-RB6

Name: Barstead MPL-RB6
Library ID: 442
Organism: Mus musculus
Strain: FVB/N
Age: 0
Stage: infant
Organ: colon
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGGATCCTTC], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Barstead MPL-RB7

Name: Barstead MPL-RB7
Library ID: 443
Organism: Mus musculus
Strain: FVB/N
Age: 0
Stage: adult
Organ: colon
Tissue: harvested 72 hours after irradiation with 1400 Gys
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Tissue obtained from 8 week old mouse. Colon was harvested 72hours after irradiation with 1400 Gys. 1st strand cDNA was primed with a Not I - oligo(dT) primer [5'TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGTCGACATG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).


Name: NCI_CGAP_Co24
Library ID: 1674
Organism: Mus musculus
Strain: FVB/N
Gender: male
Age: 0
Stage: adult
Organ: colon
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Schiller MAC13

Name: Schiller MAC13
Library ID: 1283
Organism: Mus musculus
Age: 0
Organ: colon
Tissue: colon cancer cell line MAC13
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line MAC13 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Schiller MAC16

Name: Schiller MAC16
Library ID: 1284
Organism: Mus musculus
Age: 0
Organ: colon
Tissue: colon cancer cell line MAC16
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line MAC16 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Stratagene mouse diaphragm (937303)

Name: Stratagene mouse diaphragm (937303)
Library ID: 282
Organism: Mus musculus
Age: 0
Stage: adult
Organ: diaphragm
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from diaphragm muscle. Primer: Oligo dT. Average insert size: 1.5 kb. Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Knowles/Solter egg

Name: Knowles/Solter egg
Library ID: 389
Organism: Mus musculus
Strain: B6D2F1/J
Gender: neither
Age: 0
Stage: embryo
Organ: egg
Tissue: 5000 pooled unfertilized eggs
Host: DH10B
Vector: pBluescribe (modified)
Vector type: phagemid
Insert digest: 5' MluI/SalI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from 5000 unfertilized eggs. Primer: SalI(dT): 5'-CGGTCGACCGTCGACCGTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the MluI/SalI sites of a modified pBluescribe vector using commercial linkers (NEB). Average insert size: 1.0 kb.

NIA Mouse Unfertilized Egg cDNA Library (Long 1)

Name: NIA Mouse Unfertilized Egg cDNA Library (Long 1)
Library ID: 2103
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Organ: egg
Tissue: 1488 pooled unfertilized eggs
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH ( This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from a pool of 1488 unfertilized eggs. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'], treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao.

NIA Mouse Unfertilized Egg cDNA Library (Long)

Name: NIA Mouse Unfertilized Egg cDNA Library (Long)
Library ID: 1990
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Organ: egg
Tissue: 1488 pooled unfertilized eggs
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 148 unfertilized eggs. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'), treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

Baker mouse embryo e6.5

Name: Baker mouse embryo e6.5
Library ID: 1817
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: embryo
Organ: embryo
Tissue: early gastrula
Host: XL-1 Blue
Vector: pCS105
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into SalI/NotI sites using the following 5' adaptor: 5'-TCGACCCACGCGTCCG-3'. Size-selected for average insert size 1.8-1.9 kb. Library constructed by J. Baker (Stanford University).

Baker mouse embryo e7.5

Name: Baker mouse embryo e7.5
Library ID: 1818
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: embryo
Organ: embryo
Tissue: late gastrula
Host: XL-1 Blue
Vector: pCS105
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into SalI/NotI sites using the following 5' adaptor: 5'-TCGACCCACGCGTCCG-3'. Size-selected for average insert size 1.8-1.9 kb. Library constructed by J. Baker (Stanford University).

Beddington embryonic region

Name: Beddington embryonic region
Library ID: 299
Organism: Mus musculus
Strain: C57BL/6J x DBA
Age: 0
Stage: fetal
Organ: embryo
Tissue: pooled gastrulating embryos (excluding those with head folds/extraembryonic tissues)
Host: DH12S
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Gastrulating embryos were collected at 7.5dpc from C57BL6 x DBA matings, excluding embryos that had developed head folds and all extraembryonic tissues. Average insert size: 1.3 kb (range: 0.5 - 3.0 kb) Reference: Development 121, 2479-2489 (1995).

Knowles/Solter 11.5 dpc limb bud

Name: Knowles/Solter 11.5 dpc limb bud
Library ID: 395
Organism: Mus musculus
Strain: B6D2F1/J
Age: 0
Stage: embryo
Organ: embryo
Tissue: limb bud
Host: DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' XbaI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from limb bud tissue at 11.5 days post-conception. Primer: Oligo dT. cDNAs were cloned into the XbaI/XhoI sites of pBluescript SK+ (Stratagene) using commercial linkers (NEB). Average insert size: 1.0 kb.

Knowles/Solter 2-cell

Name: Knowles/Solter 2-cell
Library ID: 390
Organism: Mus musculus
Strain: B6D2F1/J
Age: 0
Stage: embryo
Organ: embryo
Tissue: 13500 pooled 2-cell stage embryos
Host: DH10B
Vector: pBluescribe (modified)
Vector type: phagemid
Insert digest: 5' MluI/SalI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from 13,500 2-cell stage embryos. Primer: SalI(dT): 5'-CGGTCGACCGTCGACCGTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the MluI/SalI sites of a modified pBluescribe vector using commercial linkers (NEB). Average insert size: 1.2 kb.

Knowles/Solter 7.5 dpc primitive streak

Name: Knowles/Solter 7.5 dpc primitive streak
Library ID: 394
Organism: Mus musculus
Strain: B6D2F1/J
Age: 0
Stage: embryo
Organ: embryo
Tissue: primitive streak
Host: DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' XbaI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from primitive streak embryonic tissue. Primer: Oligo dT. cDNAs were cloned into the XbaI/XhoI sites of pBluescript SK+ (Stratagene) using commercial linkers (NEB). Average insert size: 1.0 kb.

Knowles/Solter 8-cell

Name: Knowles/Solter 8-cell
Library ID: 391
Organism: Mus musculus
Strain: B6D2F1/J
Age: 0
Stage: embryo
Organ: embryo
Tissue: 2000 pooled 8-cell stage
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from 2,000 8-cell stage embryos. Primer: NotI(dT): 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the NotI/SalI sites of a pSPORT vector (Life Technologies). Average insert size: 0.7 kb.

Knowles/Solter blastocyst

Name: Knowles/Solter blastocyst
Library ID: 392
Organism: Mus musculus
Strain: B6D2F1/J
Age: 0
Stage: embryo
Organ: embryo
Tissue: 800 pooled blastocysts
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from 800 blastocysts. Primer: NotI(dT): 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the NotI/SalI sites of a pSPORT vector (Life Technologies). Two different size selections: B1 (larger inserts) and B3. Average insert size of combined library is 1 kb.

Knowles/Solter E6.5dpc embryo

Name: Knowles/Solter E6.5dpc embryo
Library ID: 451
Organism: Mus musculus
Strain: B6D2F1/J
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B
Vector: pBluescribe (modified)
Vector type: phagemid
Insert digest: 5' MluI/SalI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from 6.5 dpc embryo. Primer: SalI(dT): 5'-CGGTCGACCGTCGACCGTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the MluI/SalI sites of a modified pBluescribe vector using commercial linkers (NEB).

Knowles/Solter inner cell mass

Name: Knowles/Solter inner cell mass
Library ID: 396
Organism: Mus musculus
Strain: B6D2F1/J
Age: 0
Stage: embryo
Organ: embryo
Tissue: inner cell mass
Host: DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' XbaI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from inner cell mass embryonic tissue. Primer: Oligo dT. cDNAs were cloned into the XbaI/XhoI sites of pBluescript SK+ (Stratagene) using commercial linkers (NEB). Average insert size: 0.5 kb.

Ko embryo 11.5dpc

Name: Ko embryo 11.5dpc
Library ID: 398
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: pooled whole embryos, excluding placenta and yolk sac
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Total RNAs were extracted from 11.5 dpc embryos (excluding placenta and yolk sac). The double-stranded cDNA was synthesized with an oligo (dT)-1 primer GAGAGAGACTAGTTCTAGATCGCGAGCGGCCGCTTTTTTTTTTTTTTTTTT 3'. The cDNAs were ligated to LL-Sal3A: 5' GCTATTGACGTCGACTATCC 3' and LL-Sal3B: 5' GGATAGTCGACGTCAAT 3'. The cDNAs were size-selected and amplified by long-range PCR using Ex Taq polymerase for 18 cycles. The PCR-amplifiable cDNA mixture went through one round of equalization and was digested with SalI/NotI and cloned into the SalI/NotI sites of the pSPORT1 plasmid vector (Life Technologies). The library was constructed by Dr. Minoru S. H. Ko and Dr. Xiaohong Wang.

Life Tech 10.5 dpc embryo (10665-016)

Name: Life Tech 10.5 dpc embryo (10665-016)
Library ID: 301
Organism: Mus musculus
Strain: C57BL/6J x DBA
Age: 0
Stage: embryo
Organ: embryo
Tissue: pooled embryos
Host: DH10B
Vector: pCMV-SPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. 10.5dpc embryos. pCMV-SPORT2 vector.

Life Tech 13.5 dpc embryo (10666-014)

Name: Life Tech 13.5 dpc embryo (10666-014)
Library ID: 302
Organism: Mus musculus
Strain: C57BL/6J x DBA
Age: 0
Stage: embryo
Organ: embryo
Tissue: pooled embryos
Host: DH10B
Vector: pCMV-SPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. 13.5dpc embryos. pCMV-SPORT2 vector.

Life Tech 15.5 dpc embryo (10667-012)

Name: Life Tech 15.5 dpc embryo (10667-012)
Library ID: 303
Organism: Mus musculus
Strain: C57BL/6J x DBA
Age: 0
Stage: embryo
Organ: embryo
Tissue: pooled embryos
Host: DH10B
Vector: pCMV-SPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. 15.5dpc embryos. pCMV-SPORT2 vector.

Life Tech 8.5 dpc embryo (10664-019)

Name: Life Tech 8.5 dpc embryo (10664-019)
Library ID: 300
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: pooled embryos
Host: DH10B
Vector: pCMV-SPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. 8.5dpc embryos. pCMV-SPORT2 vector.


Name: NCI_CGAP_Emb3
Library ID: 1600
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: primitive streak
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from primitive streak, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

NIA Mouse 7.5-dpc Whole Embryo cDNA Library (Long)

Name: NIA Mouse 7.5-dpc Whole Embryo cDNA Library (Long)
Library ID: 1982
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: Whole embryo including extra embryonic tissues
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of four embryos at 7.5 days postcoitum. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 7 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse 8.5-dpc Whole Embryo cDNA Library (Long)

Name: NIA Mouse 8.5-dpc Whole Embryo cDNA Library (Long)
Library ID: 1985
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: Pool of 13 embryos including extra embryonic tissues
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 13 embryos at 8.5 days postcoitum. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 9.1 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse E10.5 whole embryo cDNA library (Long)

Name: NIA Mouse E10.5 whole embryo cDNA library (Long)
Library ID: 2141
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo including extraembryonic tissues, pool of 8
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from a pool of 8 embryos at 10.5-days postcoitum. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.4Kb. The library was constructed by Yulan Piao.

NIA Mouse E11.5 whole embryo cDNA library (Long)

Name: NIA Mouse E11.5 whole embryo cDNA library (Long)
Library ID: 2142
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo including extraembryonic tissues, pool of 3
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from a pool of 3 embryos at 11.5-days postcoitum. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.3Kb. The library was constructed by Yulan Piao.

NIA Mouse E13.5 whole embryo cDNA library (Long)

Name: NIA Mouse E13.5 whole embryo cDNA library (Long)
Library ID: 2137
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo (one) including extraembryonic tissues
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from 1 embryo at 13.5-days postcoitum. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 35g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.0Kb. The library was constructed by Yulan Piao.

NIA Mouse E6.5 Whole Embryo cDNA library (Long)

Name: NIA Mouse E6.5 Whole Embryo cDNA library (Long)
Library ID: 2047
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo including extraembryonic tissues
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from a pool of seven embryos at 6.5 days post-conception. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 0.53 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pCMV-SPORT6 plasmid vector. The average insert size is about 2.3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse E9.5 Whole Embryo cDNA Library (Long)

Name: NIA Mouse E9.5 Whole Embryo cDNA Library (Long)
Library ID: 1989
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo including extraembryonic tissues
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 16 embryos at 9.5 days postcoitum. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 6 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse eight-cell-Embryo cDNA library (Long)

Name: NIA Mouse eight-cell-Embryo cDNA library (Long)
Library ID: 2143
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: 8-cell embryo, pool of 360
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). The mRNAs were extracted from a pool of 360 embryos at 8-cell stage. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 18ng of mRNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.7Kb. The library was constructed by Yulan Piao.

NIA Mouse four-cell-Embryo cDNA library (Long)

Name: NIA Mouse four-cell-Embryo cDNA library (Long)
Library ID: 2144
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: embryo
Tissue: 4-cell embryos, pool of 360
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). The mRNAs were extracted from a pool of 360 embryos at 4-cell stage. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 10.8ng of mRNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.2Kb. The library was constructed by Yulan Piao.


Name: NIH_MGC_134
Library ID: 1963
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: pool of undifferentiated limb containing undifferentiated limb mesenchyme and early condensing mesenchyme.
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.7 kb. Constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library.


Name: NIH_MGC_136
Library ID: 2003
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: embryo
Organ: embryo
Tissue: limb, maxilla and mandible: 5, 4 and 1 limb and jaw equivalents from 17.5, 18.5 and newborn days respectively
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Normalized, full-length enriched library from pool of mouse embronic limb, maxilla and mandible, embryonic day 17.5, 18.5 and newborn (mandible (5, 4 and 1 limb and jaw equivalents from respective days). Cloned directionally, oligo-dT primed (5''-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3''. Size selected for the 1kb fragments, average insert size 1.2 kb. Normalization to Cot 7.5 . Tissue contributed by David Rowe; library constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library.


Name: NIH_MGC_164
Library ID: 1997
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: Embryonic maxilla and mandible
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 10.5 and 11.5. Oligo-dT primed (5''- GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)16-3''), directionally cloned, size selected for the 0.5-1 kb fragments; average insert size 1.8 kb. Tissue contributed by David Rowe. Library constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library.


Name: NIH_MGC_409
Library ID: 2444
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_410 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_410
Library ID: 2445
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_409 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_411
Library ID: 2446
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_412 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_412
Library ID: 2447
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_411 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Soares 3NME12.5

Name: Soares 3NME12.5
Library ID: 362
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: fetal
Organ: embryo
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTTATTTTTTTTTTTTTTTTTT 3'], on total mouse RNA [provided by Minoru Ko, Wayne State Univ.]; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

Soares NbME13.5-14.5

Name: Soares NbME13.5-14.5
Library ID: 241
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: fetal
Organ: embryo
Tissue: four pooled embryos
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGGAAATTTTTTTTTTTTTTTTTTTTTTTTT 3'], on equal amounts of mRNA from 2 13.5dpc and 2 14.5dpc embryos [total RNA provided by Minoru Ko, Wayne State Univ., from 2 ]; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

Soares NMEBA

Name: Soares NMEBA
Library ID: 1498
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: branchial arch
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATGCATTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

Soares p3NMF19.5

Name: Soares p3NMF19.5
Library ID: 217
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: fetal
Organ: embryo
Tissue: whole fetus
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATGTTTTTTTTTTTTTTTTTTT 3'], on total mouse RNA [provided by Minoru Ko, Wayne State Univ.]; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

Stratagene embry. carcinoma/RA (937318)

Name: Stratagene embry. carcinoma/RA (937318)
Library ID: 292
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: embryonic carcinoma P19 cell line (ATCC CRL1825) treated with retinoic acid and allowed to differentiate
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. P19 cell line treated with retinoic acid. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Stratagene embryonic carcinoma (937317)

Name: Stratagene embryonic carcinoma (937317)
Library ID: 291
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: embryonic carcinoma P19 cell line (ATCC CRL1825), untreated
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. P19 cell line. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Sugano mouse embryo mewa

Name: Sugano mouse embryo mewa
Library ID: 721
Organism: Mus musculus
Strain: C57BL
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole
Host: DH10B
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA. REFERENCES: Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano, S. Construction and characterization of a full length-enriched and a 5' end enriched cDNA library. Gene 200, 149-156, 1997. Sasaki, Z., Suzuki, Y., Watanabe, M., Imai, J., Shibui, A., Yoshida, K., Hata. H., Yamaguchi, R., Tateyama, S., and Sugano, S. Construction of mouse full length-enriched cDNA libraries by oligo-capping. DNA Research, submitted.

Yamada E13.5 limb bud

Name: Yamada E13.5 limb bud
Library ID: 1320
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: molar
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without

Yamada E13.5 tooth germ

Name: Yamada E13.5 tooth germ
Library ID: 1318
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: tooth germ
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without

Yamada E8.5 uni-craniofacial

Name: Yamada E8.5 uni-craniofacial
Library ID: 1317
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: embryo
Tissue: uni-craniofacial tissue
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without

Knowles/Solter ES cell

Name: Knowles/Solter ES cell
Library ID: 393
Organism: Mus musculus
Strain: B6D2F1/J
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: J1
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from 800 ES cells. Primer: SalI(dT): 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the NotI/SalI sites of a pSPORT vector (Life Technologies). Average insert size 1.3 kb.

NIA Mouse Embryonic Stem (ES) cell (Lif+, 48 h, high density) cDNA library (Long)

Name: NIA Mouse Embryonic Stem (ES) cell (Lif+, 48 h, high density) cDNA library (Long)
Library ID: 2138
Organism: Mus musculus
Strain: 129Sv/EvTac
Gender: male
Age: 0
Organ: embryonic stem cell
Tissue: 129.3 ES cell line
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). ES cells were plated at density 3x104/cm2, on gelatin-coated plates and cultured for 48 hrs at 37 OC, 5% CO2. Culture medium: DMEM supplemented with 15% FBS, 2 mM L-glutamine, 0.1 mM NEAA, 1mM Sodium pyruvate, 0.1 mM beta-mercaptoethanol, 1000 U/ml LIF, 100 U/ml penicillin, and 100 ug/ml streptomycin. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.7 kb. The library was constructed by Yulan Piao.

NIA Mouse Embryonic Stem (ES) cell (Lif-, 48 h, high density) cDNA library (Long)

Name: NIA Mouse Embryonic Stem (ES) cell (Lif-, 48 h, high density) cDNA library (Long)
Library ID: 2140
Organism: Mus musculus
Strain: 129Sv/EvTac
Gender: male
Age: 0
Organ: embryonic stem cell
Tissue: 129.3 ES cell line
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). ES cells were plated at density 3x104/cm2, on gelatin-coated plates and cultured for 48 hrs at 37 OC, 5% CO2. Culture medium: DMEM supplemented with 15% FBS, 2 mM L-glutamine, 0.1 mM NEAA, 1mM Sodium pyruvate, 0.1 mM beta-mercaptoethanol, 100 U/ml penicillin, and 100 ug/ml streptomycin. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.4 kb. The library was constructed by Yulan Piao.

NIA Mouse Embryonic Stem (ES) cell (Lif-, 48 h, low density) cDNA library (Long)

Name: NIA Mouse Embryonic Stem (ES) cell (Lif-, 48 h, low density) cDNA library (Long)
Library ID: 2139
Organism: Mus musculus
Strain: 129Sv/EvTac
Gender: male
Age: 0
Organ: embryonic stem cell
Tissue: 129.3 ES cell line
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). ES cells were plated at density 3x103/cm2, on gelatin-coated plates and cultured for 48 hrs at 37 OC, 5% CO2. Culture medium: DMEM supplemented with 15% FBS, 2 mM L-glutamine, 0.1 mM NEAA, 1mM Sodium pyruvate, 0.1 mM beta-mercaptoethanol, 100 U/ml penicillin, and 100 ug/ml streptomycin. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.8 kb. The library was constructed by Yulan Piao.

NIA Mouse ES Cell (LIF-) cDNA Library (Long)

Name: NIA Mouse ES Cell (LIF-) cDNA Library (Long)
Library ID: 1991
Organism: Mus musculus
Strain: 129/Sv x 129S1/Sv-p<+> Tyr-c<+>
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic Stem Cell (LIF-)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Kenneth R. Boheler (National Insitute on Aging, USA). ES cells were cultured without feeder cells in the absence of LIF for 4 or 18 hours. Equimolar mixtures of these RNA samples were used for library construction. Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'), treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.4 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Undifferentiated Embryonic Stem (ES) Cell cDNA Library (Long 1)

Name: NIA Mouse Undifferentiated Embryonic Stem (ES) Cell cDNA Library (Long 1)
Library ID: 2102
Organism: Mus musculus
Strain: 129/Sv x 129S1/Sv-p<+> Tyr-c<+>
Age: 0
Organ: embryonic stem cell
Tissue: undifferentiated embryonic stem cells
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH ( This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Dr. Kenneth R. Boheler (National Institute on Aging, USA). ES cells were cultured without feeder cells in the presence of LIF and BRL-conditioned media. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 14.2 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.4 kb. The library was constructed by Yulan Piao.

NIA Mouse Undifferentiated ES Cell cDNA Library (Long)

Name: NIA Mouse Undifferentiated ES Cell cDNA Library (Long)
Library ID: 1992
Organism: Mus musculus
Strain: 129/Sv x 129S1/Sv-p<+> Tyr-c<+>
Age: 0
Organ: embryonic stem cell
Tissue: undifferentiated embryonic stem cells
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Kenneth R. Boheler (National Insitute on Aging, USA). ES cells were cultured without feeder cells in the presence of LIF and BRL-conditioned media. Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 14.2 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.4 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

Soares NMES

Name: Soares NMES
Library ID: 950
Organism: Mus musculus
Age: 0
Stage: fetal
Organ: embryonic stem cell
Tissue: embryonic stem cell
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATTGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through two rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.


Library ID: 2023
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: eye
Tissue: whole eye, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse eye tissue, embryonic days 15, 16, 17 and 18. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCTGCGTCCTCTTTTTTTTTTTTTTTTTT-3') contains the sequence tag CTGCGTCCTC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2072
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: eye
Tissue: whole eye, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse eye tissue, embryonic days 15, 16, 17 and 18. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCTGCGTCCTCTTTTTTTTTTTTTTTTTT-3') contains the sequence tag CTGCGTCCTC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2065
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: eye
Tissue: pooled eye
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2066
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: eye
Tissue: pooled eye
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2067
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: eye
Tissue: pooled eye
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5 (size selected for 4-5 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2068
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: eye
Tissue: pooled eye
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2069
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: eye
Tissue: pooled eye
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2129
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: eye
Tissue: pooled eye
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5 (size selected for 5-7 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2155
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: eye
Tissue: whole eye, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled mouse eye Tissue, embryonic days 15, 16, 17 and 18. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCTGCGTCCTCTTTTTTTTTTTTTTTTTT-3') contains the sequence tag CTGCGTCCTC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2162
Organism: Mus musculus
Age: 0
Stage: juvenile
Organ: eye
Tissue: whole eye, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from whole eye (pooled postnatal days 1, 5 and 15). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2163
Organism: Mus musculus
Age: 0
Stage: juvenile
Organ: eye
Tissue: whole eye, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from whole eye (pooled postnatal days 1, 5 and 15). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2164
Organism: Mus musculus
Age: 0
Stage: juvenile
Organ: eye
Tissue: whole eye, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from whole eye (pooled postnatal days 1, 5 and 15). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2165
Organism: Mus musculus
Age: 0
Stage: mixed
Organ: eye
Tissue: whole eye, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from whole eye (pooled postnatal days 1, 5 and 15 and embryonic 15.5-16, 16.5, 17.5 and 18.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2166
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: eye
Tissue: whole eye, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from whole eye (pooled embryonic days 15.5-16, 16.5, 17.5 and 18.5). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCXXXXXXXXXXTTTTTTTTTTTTTTTTTT-3') contains the sequence tags CTGCGTCCTC or AGAGGAGACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2211
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: eye
Tissue: whole eye, pooled
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from whole eye (pooled embryonic days 15.5-16, 16.5, 17.5 and 18.5). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCXXXXXXXXXXTTTTTTTTTTTTTTTTTT-3') contains the sequence tags CTGCGTCCTC or AGAGGAGACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2212
Organism: Mus musculus
Age: 0
Stage: mixed
Organ: eye
Tissue: whole eye
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from whole eye (pooled juvenile days 1, 5 and 15 and embryonic days 15, 16, 17 and 18). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2213
Organism: Mus musculus
Age: 0
Stage: juvenile
Organ: eye
Tissue: whole eye
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from whole eye (pooled embryonic days 15.5-16, 16.5, 17.5 and 18.5). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Name: NIH_MGC_94
Library ID: 1730
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Organ: eye
Tissue: retina
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 3.3 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.

Rashbass MOC-10.5

Name: Rashbass MOC-10.5
Library ID: 1291
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: embryo
Organ: eye
Tissue: developing eye, including optic placode and lens cup
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without

Rashbass MOC-11.5

Name: Rashbass MOC-11.5
Library ID: 1292
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: embryo
Organ: eye
Tissue: developing eye, including optic cup and lens vesicle
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: mRNA made from developing eye tissue, cDNA made by oligo-dT priming with NotI oligo. SalI adaptor (5'-TCGACCCACGCGTCCG-3') ligated to 5' ends. Size-selected with cDNA size fractionation resin, average insert size 1.3 kb. Primary library, non-amplified. Library constructed by Dr. Pen Rashbass (

Rashbass MOV-9.5

Name: Rashbass MOV-9.5
Library ID: 1290
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: embryo
Organ: eye
Tissue: developing eye including optic vesicle and lens placode
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: mRNA made from developing eye tissue, cDNA made by oligo-dT priming with NotI oligo. SalI adaptor (5'-TCGACCCACGCGTCCG-3') ligated to 5' ends. Size-selected with cDNA size fractionation resin, average insert size 1.3 kb. Primary library, non-amplified. Library constructed by Dr. Pen Rashbass (

NIA Mouse 12.5-dpc Male Genital Ridge/Mesonephros cDNA Library (Long)

Name: NIA Mouse 12.5-dpc Male Genital Ridge/Mesonephros cDNA Library (Long)
Library ID: 1984
Organism: Mus musculus
Strain: C57BL/6J
Gender: male
Age: 0
Stage: embryo
Organ: Genital Ridge
Tissue: Genital Ridge/Mesonephros
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 1.8 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.4 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Embryonic Germ Cell cDNA Library (Long)

Name: NIA Mouse Embryonic Germ Cell cDNA Library (Long)
Library ID: 1988
Organism: Mus musculus
Strain: C57BL/6J
Gender: male
Age: 0
Stage: embryo
Organ: germ cell
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Mark G. Carter (NIH/NIA-IRP). EG cells were cultured at 37C, 5%CO2 in DMEM supplemented with 15% ES cell-qualified FBS, 0.1mM non-essential amino acids, 2mM glutamine, penicillin/streptomycin, 1mM sodium pyruvate, 0.1mM beta- mercaptoethanol, and 10e7 units of LIF per liter. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2.5 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 4 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Embryonic Germ Cell cDNA Library (Long, subtracted)

Name: NIA Mouse Embryonic Germ Cell cDNA Library (Long, subtracted)
Library ID: 2104
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: embryo
Organ: germ cell
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH ( This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). EG cells were obtained from Dr. Brigid L.M. Hogan and RNA was prepared by Dr. Mark G. Carter (NIH/NIA-IRP). EG cells were cultured at 37? C, 5% CO2 in DMEM supplemented with 15% ES cell-qualified FBS, 0.1mM non-essential amino acids, 2 mM glutamine, penicillin/streptomycin, 1 mM sodium pyruvate, 0.1 mM beta-mercaptoethanol, and 10^7 units of LIF per liter. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 2.5 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were double digested with Not1 and Sal1 enzymes, then purified by phenol/chloroform and Centricon 100. The cDNA mixture was subjected to a special subtraction procedure by Dr.Kazuhiro Kondo at AISIN Cosmos. Then the subtracted cDNAs were cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.2kb. The library was constructed by Yulan Piao and Kazuhiro Kondo.

Soares NMUR

Name: Soares NMUR
Library ID: 956
Organism: Mus musculus
Strain: 3H1
Gender: both
Age: 0
Stage: fetal
Organ: gonad
Tissue: urogenital ridge - pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATTTCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through two rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.


Library ID: 1631
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: head/neck
Tissue: normal salivary gland
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Library ID: 2128
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: head/neck
Tissue: upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc)
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc) (size selected for 2-3 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2130
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: head/neck
Tissue: upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc)
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc) (size selected for 0.5-1 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2131
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: head/neck
Tissue: upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc)
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc) (size selected for 1-2 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2152
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: head/neck
Tissue: upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc)
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2153
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: head/neck
Tissue: upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc)
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2154
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: head/neck
Tissue: upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc)
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.


Library ID: 2161
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: head/neck
Tissue: upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc)
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Barstead MPL-RB3

Name: Barstead MPL-RB3
Library ID: 365
Organism: Mus musculus
Strain: BALB/c
Gender: both
Age: 0
Stage: adult
Organ: heart
Tissue: four pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGGATCCAAG and CTTGGATTCG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).


Name: NCI_CGAP_Ht1
Library ID: 1694
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: heart
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.54 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_156
Library ID: 1979
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: heart
Tissue: Heart: TCDD (DMSO vehicle) treated 48 hours IP injection, pool of 3
Host: DH10B TonA
Vector: pDONR201
Vector type: plasmid
Insert digest: 5' attP2/attP1
Stop Codon Status: without
Description: cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.

Soares NbMH

Name: Soares NbMH
Library ID: 397
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: heart
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAAAGTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Minoru Ko, Wayne State Univ. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

Stratagene mouse heart (937316)

Name: Stratagene mouse heart (937316)
Library ID: 290
Organism: Mus musculus
Strain: NIH Swiss
Age: 0
Stage: embryo
Organ: heart
Tissue: 93 pooled hearts
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. 93 pooled NIH/Swiss 13 day embryo hearts. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Name: NIH_MGC_130
Library ID: 1937
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: embryo
Organ: inner ear
Tissue: otocysts
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.95 kb. Constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library.

Organ of Corti

Name: Organ of Corti
Library ID: 2056
Organism: Mus musculus
Strain: BALB/c
Gender: both
Age: 0
Stage: juvenile
Organ: inner ear
Tissue: Ear - Organ of Corti (sensory hearing epithelial tissue within the inner ear). Pooled from several tissues from one or more individulas: pooled from 364 organs of Corti. Expect the following cell types to be present: inner and outer hair cells, Deiters cells, Hensen cells, inner and outer phalangeal cells. There also may be some neuronal cells, fibroblast and blood cells.
Host: DH10B TonA
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: The organ of Corti (OC) was fine dissected from a total of 386 OC as follows: 102 samples from post-natal (P) day 5; 72 from P6; 60 from P7; 46 from P8; 18 from P9; 20 from P10; 14 from P12 and 24 from P13. Total RNA was extracted using the micro Fasttrack kit (catalog # K1593-02; Invitrogen, Carlsbad, CA), according to manufacturer's instructions. Reverse transcription and library construction were carried out with the Uni-Zap XR vector kit (catalog # 237211, Stratagene) and Uni-Zap XR Gigapack III Gold Cloning kit (catalog # 237612), both from Stratagene (La Jolla, CA, USA), according to manufacturer's instructions. The frequency distribution of the library is as follows: 72% of genes have 1 copy; 14.3% 2; 12% 3-10; 1.4% 11-50 and 0.1% 51-150. As to gene function, 45% of genes are present in GenBank and have know function; 23% have hits in GenBank,but do not have assigned function; 12% are uncharacterized ESTs and 20% are unidentified. Library created in the laboratory of M. Brownstein (NIMH, NIH). A complete library decription can be found at NCBI.

Soares NMIE

Name: Soares NMIE
Library ID: 1397
Organism: Mus musculus
Strain: C3H x 101
Gender: male
Age: 0
Stage: infant
Organ: inner ear
Tissue: pool of 170
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACACTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed and donated by Bento Soares and M.Fatima Bonaldo (University of Iowa) and R. Hardisty, A. Varela-Carver, P. Mburu and S.D.M. Brown (MRC UK Mouse Genome Centre and Mammalian Genetics Unit, Harwell, UK).

Barstead MPL-RB1

Name: Barstead MPL-RB1
Library ID: 310
Organism: Mus musculus
Strain: BALB/c
Gender: both
Age: 0
Stage: adult
Organ: kidney
Tissue: pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5'-TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT-3']; double-stranded cDNA was ligated to Eco RI adaptors [5'-AATTCGGATCCAAG-3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Beier day 0 kidney

Name: Beier day 0 kidney
Library ID: 358
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: infant
Organ: kidney
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Library provided by David Beier and Lisa Guay-Woodford.

Beier day 7 kidney

Name: Beier day 7 kidney
Library ID: 359
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: juvenile
Organ: kidney
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Library provided by David Beier and Lisa Guay-Woodford.


Name: NCI_CGAP_Ki15
Library ID: 1695
Organism: Mus musculus
Gender: female
Age: 0
Stage: juvenile
Organ: kidney
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Kid14
Library ID: 1675
Organism: Mus musculus
Strain: FVB/N
Gender: male
Age: 0
Stage: adult
Organ: kidney
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.75 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

NIA Mouse Newborn Kidney cDNA Library (Long 1)

Name: NIA Mouse Newborn Kidney cDNA Library (Long 1)
Library ID: 2097
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: infant
Organ: kidney
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH ( This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). In brief, double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 26 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.0 kb. The library was constructed by Yulan Piao.

NIA Mouse Newborn Kidney cDNA Library (Long)

Name: NIA Mouse Newborn Kidney cDNA Library (Long)
Library ID: 1981
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: infant
Organ: kidney
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 26 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].


Name: NIH_MGC_154
Library ID: 1977
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: kidney
Tissue: DMSO control treated 48 hours IP injection, pool of 3
Host: DH10B TonA
Vector: pDONR201
Vector type: plasmid
Insert digest: 5' attP2/attP1
Stop Codon Status: without
Description: cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.


Name: NIH_MGC_176
Library ID: 2007
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: kidney
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5 kb size fraction. Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library.

Stratagene mouse kidney (937315)

Name: Stratagene mouse kidney (937315)
Library ID: 289
Organism: Mus musculus
Strain: C57BL/6J
Gender: female
Age: 0
Stage: adult
Organ: kidney
Tissue: pooled
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Sugano mouse kidney mkia

Name: Sugano mouse kidney mkia
Library ID: 718
Organism: Mus musculus
Strain: C57BL
Gender: female
Age: 0
Stage: adult
Organ: kidney
Host: DH10B
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA. REFERENCES: Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano, S. Construction and characterization of a full length-enriched and a 5' end enriched cDNA library. Gene 200, 149-156, 1997. Sasaki, Z., Suzuki, Y., Watanabe, M., Imai, J., Shibui, A., Yoshida, K., Hata. H., Yamaguchi, R., Tateyama, S., and Sugano, S. Construction of mouse full length-enriched cDNA libraries by oligo-capping. DNA Research, submitted.


Name: NCI_CGAP_Cec1
Library ID: 1715
Organism: Mus musculus
Gender: female
Age: 0
Stage: juvenile
Organ: large intestine
Tissue: cecum
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 2.445 kb. Library constructed by Life Technologies. Note: This is an NCI_CGAP library.


Name: NIH_MGC_135
Library ID: 1996
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: limb
Tissue: Embryonic limb, maxilla and mandible
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 12.5, 13.5, 14.5, and 15.5. Oligo-dT primed (5''- GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)16-3''), directionally cloned, size selected for the 0.5-1 kb fragments; average insert size 1.6 kb. Normalized to Cot 7.5. Tissue contributed by David Rowe. Library constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library.


Name: NCI_CGAP_Li10
Library ID: 1632
Organism: Mus musculus
Gender: female
Age: 0
Stage: juvenile
Organ: liver
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Li9
Library ID: 1672
Organism: Mus musculus
Strain: FVB/N
Gender: male
Age: 0
Stage: adult
Organ: liver
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.9 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_152
Library ID: 1975
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: liver
Tissue: DMSO control treated for 288 hours IP injection., pool of 3
Host: DH10B TonA
Vector: pDONR201
Vector type: plasmid
Insert digest: 5' attP2/attP1
Stop Codon Status: without
Description: cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.


Name: NIH_MGC_153
Library ID: 1976
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: liver
Tissue: Liver: TCDD (DMSO vehicle) Treated 288 hours IP injection. Pooled.
Host: DH10B TonA
Vector: pDONR201
Vector type: plasmid
Insert digest: 5' attP2/attP1 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.


Name: NIH_MGC_177
Library ID: 2008
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: liver
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5 kb size fraction. Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library.

Soares NML

Name: Soares NML
Library ID: 360
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: liver
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAATCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

Sugano mouse liver mlia

Name: Sugano mouse liver mlia
Library ID: 717
Organism: Mus musculus
Strain: C57BL
Gender: female
Age: 0
Stage: adult
Organ: liver
Host: DH10B
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA. REFERENCES: Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano, S. Construction and characterization of a full length-enriched and a 5' end enriched cDNA library. Gene 200, 149-156, 1997. Sasaki, Z., Suzuki, Y., Watanabe, M., Imai, J., Shibui, A., Yoshida, K., Hata. H., Yamaguchi, R., Tateyama, S., and Sugano, S. Construction of mouse full length-enriched cDNA libraries by oligo-capping. DNA Research, submitted.

Barstead MPL-RB2

Name: Barstead MPL-RB2
Library ID: 364
Organism: Mus musculus
Strain: BALB/c
Gender: both
Age: 0
Stage: adult
Organ: lung
Tissue: four pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5'-TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT-3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGGATCCATC and GATGGATTCG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).


Name: NCI_CGAP_Lu29
Library ID: 1368
Organism: Mus musculus
Gender: female
Age: 0
Stage: juvenile
Organ: lung
Tissue: spontaneous lung tumor, metastatic to mammary. Stem cell origin.
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert 1.9 kb. Library constructed by Life Technologies, catalog #12023-016. Investigator providing samples: Gilbert Smith, NIH Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu30
Library ID: 1365
Organism: Mus musculus
Gender: female
Age: 0
Organ: lung
Tissue: lung tumor metastatic to mammary
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert 1.5 kb. Library constructed by Life Technologies, catalog #12024-014. Investigator providing samples: Gilbert Smith, NIH Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu33
Library ID: 1433
Organism: Mus musculus
Age: 0
Organ: lung
Tissue: pooled lung cancers
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from mRNA obtainedfrom pooled lung tumors with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTCTGTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa). Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu35
Library ID: 1696
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: lung
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_155
Library ID: 1978
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: lung
Tissue: Lung: TCDD ( DMSO vehicle) treated 48 hours IP injection, pool of 3
Host: DH10B TonA
Vector: pDONR201
Vector type: plasmid
Insert digest: 5' attP2/attP1
Stop Codon Status: without
Description: cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.


Name: NIH_MGC_413
Library ID: 2448
Organism: Mus musculus
Age: 0
Organ: lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_414 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_414
Library ID: 2449
Organism: Mus musculus
Age: 0
Organ: lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_413 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_415
Library ID: 2450
Organism: Mus musculus
Age: 0
Organ: lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_416 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_416
Library ID: 2451
Organism: Mus musculus
Age: 0
Organ: lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_415 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Stratagene mouse lung (937302)

Name: Stratagene mouse lung (937302)
Library ID: 284
Organism: Mus musculus
Strain: C57BL/6J x DBA
Gender: both
Age: 0
Stage: adult
Organ: lung
Tissue: pool of 2
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. 6-8 month old female lung and 1.5 year old male lung were source of mRNA. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Soares NbMLN

Name: Soares NbMLN
Library ID: 328
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: lymph node
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATACTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Bertrand Jordan. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

Stratagene mouse macrophage (937306)

Name: Stratagene mouse macrophage (937306)
Library ID: 283
Organism: Mus musculus
Age: 0
Stage: adult
Organ: macrophage
Tissue: WEHI-3 cell line
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. WEHI-3 cell line. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3'


Name: NCI_CGAP_Mam1
Library ID: 1367
Organism: Mus musculus
Strain: FVB/N
Gender: female
Age: 0
Stage: adult
Organ: mammary gland
Tissue: mammary tumor
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert 1.7 kb. Library constructed by Life Technologies, catalog #12015-012. Investigator providing samples: Gilbert Smith, NIH Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Mam10
Library ID: 1432
Organism: Mus musculus
Age: 0
Organ: mammary gland
Tissue: pooled mammary gland tumors
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from mRNA obtainedfrom pooled mammary gland tumors with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACTAGTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa). Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Mam2
Library ID: 1366
Organism: Mus musculus
Strain: FVB-3
Gender: female
Age: 0
Stage: adult
Organ: mammary gland
Tissue: mammary tumor, biopsy, some areas of necrosis in tumor center, otherwise firm, white with good blood supply
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert 1.7 kb. Library constructed by Life Technologies, catalog #12016-010. Investigator providing samples: Gilbert Smith, NIH Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Mam3
Library ID: 1364
Organism: Mus musculus
Strain: 129 - C57/B6 - FVB/N
Gender: female
Age: 0
Stage: adult
Organ: mammary gland
Tissue: mammary tumor, gross tissue
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert 2 kb. Library constructed by Life Technologies, catalog #12017-018. Investigators providing samples: Lothar Hennighausen/Chu-Xia Deng, NIH Reference for transgenic model: Xu et al., Nature Genetics 22, 37-43 (1999). Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Mam4
Library ID: 1363
Organism: Mus musculus
Strain: NMRI
Gender: female
Age: 0
Stage: adult
Organ: mammary gland
Tissue: mammary tumor, gross tissue
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert 2.5 kb. Library constructed by Life Technologies, catalog # 12018-016. Investigators providing samples: Lothar Hennighausen/Priscilla Furth, NIH Reference for transgenic model: Li et al., Cell Growth and Differentiation 7, 3-11 (1996). Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Mam5
Library ID: 1362
Organism: Mus musculus
Strain: C57BL/6
Gender: female
Age: 0
Stage: adult
Organ: mammary gland
Tissue: mammary tumor, gross tissue
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert 2 kb. Library constructed by Life Technologies, catalog #12019-014. Investigators providing samples: Lothar Hennighausen/Robin Humphreys, NIH Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Mam6
Library ID: 1361
Organism: Mus musculus
Strain: FVB/N
Gender: female
Age: 0
Stage: adult
Organ: mammary gland
Tissue: infiltrating ductal carcinoma
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert 2.6 kb. Library constructed by Life Technologies, catalog #120222-018. Investigator providing samples: Jeffrey Green, M.D., NIH Note: this is a NCI_CGAP Library.

Soares NbMMG

Name: Soares NbMMG
Library ID: 403
Organism: Mus musculus
Strain: C57BL/6
Gender: female
Age: 0
Stage: adult
Organ: mammary gland
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAATGGTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Minoru Ko, Wayne State Univ. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

Soares NMLMG

Name: Soares NMLMG
Library ID: 636
Organism: Mus musculus
Strain: C57BL/6
Gender: female
Age: 0
Stage: adult
Organ: mammary gland
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from mammary gland tissue from a lactating female, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTTCTTTTTTTTTTTTTTTTTTTTTTTT-3'. Double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Library was constructed by Bento Soares and M. Fatima Bonaldo.

Soares NKWMD

Name: Soares NKWMD
Library ID: 1568
Organism: Mus musculus
Age: 0
Organ: mandible
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTTAATTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.

Soares NMMAX

Name: Soares NMMAX
Library ID: 1569
Organism: Mus musculus
Age: 0
Organ: maxillary process
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGCGCTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.

Stratagene mouse melanoma (937312)

Name: Stratagene mouse melanoma (937312)
Library ID: 287
Organism: Mus musculus
Age: 0
Stage: adult
Organ: melanoma
Tissue: M2 cell, a highly metastatic derivative of the K-1735 mouse melanoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. From M2 cells, a highly metastatic derivative of the K-1735 (mouse) melanoma. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT

Barstead MPL-RB4

Name: Barstead MPL-RB4
Library ID: 366
Organism: Mus musculus
Strain: FVB/N
Gender: both
Age: 0
Stage: infant
Organ: mixed
Tissue: pooled organs from multiple mice
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGGATCCAAC and GTTGGATTCG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).


Name: NIH_MGC_178
Library ID: 2009
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: mixed
Tissue: lung and heart
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5 kb size fraction. Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library.


Name: NIH_MGC_284
Library ID: 2253
Organism: Mus musculus
Age: 0
Organ: mixed
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Library was constructed from RT-PCR products. Inserts are cloned into the TOPO site and oriented with 5' end nearest the SpeI site and 3' end nearest the PstI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_285 has clones in the opposite orientation. Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a NIH_MGC Library


Name: NIH_MGC_285
Library ID: 2254
Organism: Mus musculus
Age: 0
Organ: mixed
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Library was constructed from RT-PCR products. Inserts are cloned into the TOPO site and oriented with 5' end nearest the PstI site and 3' end nearest the SpeI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_284 has clones in the opposite orientation. Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a NIH_MGC Library


Name: NIH_MGC_389
Library ID: 2404
Organism: Mus musculus
Age: 0
Organ: mixed
Tissue: pool of brain, thymus, testicle, kidney, spleen, liver, heart, lung, ovary and embryo
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_390 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_390
Library ID: 2405
Organism: Mus musculus
Age: 0
Organ: mixed
Tissue: pool of brain, thymus, testicle, kidney, spleen, liver, heart, lung, ovary and embryo
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_389 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_391
Library ID: 2406
Organism: Mus musculus
Age: 0
Organ: mixed
Tissue: pool of brain, thymus, testicle, kidney, spleen, liver, heart, lung, ovary and embryo
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_392 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_392
Library ID: 2407
Organism: Mus musculus
Age: 0
Organ: mixed
Tissue: pool of brain, thymus, testicle, kidney, spleen, liver, heart, lung, ovary and embryo
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_391 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_393
Library ID: 2412
Organism: Mus musculus
Age: 0
Organ: mixed
Tissue: pooled brain and spleen
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_394 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_394
Library ID: 2413
Organism: Mus musculus
Age: 0
Organ: mixed
Tissue: pooled brain and spleen
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_393 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_395
Library ID: 2414
Organism: Mus musculus
Age: 0
Organ: mixed
Tissue: pooled brain and spleen
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_396 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_396
Library ID: 2415
Organism: Mus musculus
Age: 0
Organ: mixed
Tissue: pooled brain and spleen
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_395 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Library ID: 1673
Organism: Mus musculus
Strain: FVB/N
Gender: female
Age: 0
Stage: juvenile
Organ: mouth
Tissue: salivary gland
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Barstead MPL-RB13

Name: Barstead MPL-RB13
Library ID: 1065
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: muscle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGTCGACAAG 3' and 5' CTTGTCGACG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Barstead MPL-RB14

Name: Barstead MPL-RB14
Library ID: 1314
Organism: Mus musculus
Gender: male
Age: 0
Organ: muscle
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [5' AATTCGTCGACAAG 3' and 5' CTTGTCGACG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Barstead MPL-RB5

Name: Barstead MPL-RB5
Library ID: 441
Organism: Mus musculus
Strain: C3H
Age: 0
Organ: muscle
Tissue: stromal cell line C2C12, induced to differentiate into myotubes
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGGATCCTTG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation). The C2C12 cell line (available from ATCC, catalog # CRL-1772) differentiates rapidly, forming contractile myotubes and producing characteristic muscle proteins.

Barstead MPL-RB8

Name: Barstead MPL-RB8
Library ID: 563
Organism: Mus musculus
Age: 0
Organ: muscle
Tissue: undifferentiated tissue culture cell line C2C12
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGTCGACAAG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation). Source undifferentiated tissue culture cell line C2C12. Library constructed by Bob Barstead. The C2C12 cell line (available from ATCC, catalog # CRL-1772) differentiates rapidly, forming contractile myotubes and producing characteristic muscle proteins.


Name: NCI_CGAP_Mu1
Library ID: 1718
Organism: Mus musculus
Gender: female
Age: 0
Stage: juvenile
Organ: muscle
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 2.260 kb. Library constructed by Life Technologies. Note: This is an NCI_CGAP library.


Name: Soares NMKWNP
Library ID: 1304
Organism: Mus musculus
Age: 0
Organ: nasal process
Tissue: medial nasal process
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from medial nasal process tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGAGCATTTCTTTTTTTTTTTTTTTTTTTTTTTT-3'. Double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Library was constructed by Bento Soares and M. Fatima Bonaldo.


Name: NIH_MGC_129
Library ID: 1936
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: infant
Organ: olfactory epithelium
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.2 kb. Constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library.


Name: NIH_MGC_399
Library ID: 2442
Organism: Mus musculus
Age: 0
Stage: adult
Organ: olfactory epithelium
Host: DH5alpha T1-resistant
Vector: pENTR223
Vector type: Gateway entry vector
Insert digest: 5' attL1.1/attL2.1 3'
Stop Codon Status: without
Description: Olfactory receptor cDNAs from adult mouse (RNA provided by Leslie Vosshall; clones selected by screening olfactory receptor cDNA libraries at low stringency with probes prepared by degenerate PCR, using primers to conserved sequences of the olfactory receptor gene family (Genome Biology 4:R71, and provided by Janet Young, Fred Hutchinson Cancer Research Center) were used as the starting template. 8 ul of each clone was inoculated in 1 ml LB containing the appropriate antibiotic. A BP recombinational reaction contains 2 ul of 5 X BP3 buffer; 2 ul of BP clonase; 1 ul of pDONR223 (150 ng/uL); 2 ul of PCR product (2-200 ng/uL); 3 uL H2O. The 5 X BP3 buffer consists of 100 mM Tris-Cl (pH 7.5); 20 mM EDTA; 30 mM spermidine-HCL; 25 percent glycerol; 225 mM NaCl. LR reactions we performed as described previously with minor changes (Reboul et al. 2003, Rual et al. 2004). BP products were transformed into liquid cultures of E. coli, with antibiotic selection of spectinomycin at 50 ug/mL. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGC-ORF-TTGccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Dana Farber Cancer Institute, Center for Cancer Systems Biology for the ORFeome Collaboration.


Name: NIH_MGC_400
Library ID: 2443
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: olfactory epithelium
Host: DH5alpha T1-resistant
Vector: pENTR223
Vector type: Gateway entry vector
Insert digest: 5' attL1.1/attL2.1 3'
Stop Codon Status: without
Description: Olfactory receptor cDNAs from embryonic 16.5-18.5 day mouse (RNA provided by Tyler Cutforth; clones selected by screening olfactory receptor cDNA libraries at low stringency with probes prepared by degenerate PCR, using primers to conserved sequences of the olfactory receptor gene family (Genome Biology 4:R71, and provided by Janet Young, Fred Hutchinson Cancer Research Center) were used as the starting template. 8 ul of each clone was inoculated in 1 ml LB containing the appropriate antibiotic. A BP recombinational reaction contains 2 ul of 5 X BP3 buffer; 2 ul of BP clonase; 1 ul of pDONR223 (150 ng/uL); 2 ul of PCR product (2-200 ng/uL); 3 uL H2O. The 5 X BP3 buffer consists of 100 mM Tris-Cl (pH 7.5); 20 mM EDTA; 30 mM spermidine-HCL; 25 percent glycerol; 225 mM NaCl. LR reactions we performed as described previously with minor changes (Reboul et al. 2003, Rual et al. 2004). BP products were transformed into liquid cultures of E. coli, with antibiotic selection of spectinomycin at 50 ug/mL. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGC-ORF-TTGccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Dana Farber Cancer Institute, Center for Cancer Systems Biology for the ORFeome Collaboration.

Eppig/Hampl oocyte

Name: Eppig/Hampl oocyte
Library ID: 1182
Organism: Mus musculus
Strain: C57BL/6
Gender: female
Age: 0
Stage: adult
Organ: oocyte
Tissue: oocyte isolated 46 hrs after PMSG injection
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from mRNA prepared from oocytes isolated 46 hours after PMSG injection. NotI(dT) primer: 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. SalI linker: 5'-TCGACCCACGCGTCCG-3'. cDNAs were size-selected for 500 bp and cloned into the SalI/NotI sites of pSPORT vector (Life Technologies). Average insert size: 1.5 kb. For aliquots of this library, please contact Dr. John Eppig, The Jackson Laboratory, 600 Main St., Bar Harbor ME 04609.


Name: NIH_MGC_256
Library ID: 2191
Organism: Mus musculus
Strain: C57BL/6J
Gender: female
Age: 0
Stage: juvenile
Organ: oocyte
Tissue: 11,000 denuded oocytes in meiotic prophase arrest oocytes were collected from 175 mice. Oocytes were collected in Gibco Liebovitz L-15 medium supplemented with 5% fetal calf serum, 100 IU/ml penicillin/streptomycin and 5uM cilostamide. Excised ovaries were punctured with 27 ga needles and cumulus enclosed oocytes were collected. The oocytes were mechanically denuded with a fine bore pipette and freed of cumulus and granulosa cells by serial dilutions. The denuded oocytes were rinsed twice in PBS, collected in 3 ul, and transferred to a microfuge tube. 30 ul of Trizol was added to each tube, which was vortexed for 5 seconds, then centrifuged briefly before snap freezing in liquid nitrogen and then stored at -70o. Mice (2325 days old) were injected IP with 5 IU of PMSG to stimulate follicle growth. Forty-four to forty eight hours later, animals were sacrificed and ovaries were excised
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.5 kb resulted in an average insert size of 1.2 kb. This is a primarylibrary (normalized primary library is NIH_MGC_257) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.


Name: NIH_MGC_257
Library ID: 2192
Organism: Mus musculus
Strain: C57BL/6
Gender: female
Age: 0
Stage: juvenile
Organ: oocyte
Tissue: 11,000 denuded oocytes in meiotic prophase arrest oocytes were collected from 175 mice. Oocytes were collected in Gibco Liebovitz L-15 medium supplemented with 5% fetal calf serum, 100 IU/ml penicillin/streptomycin and 5uM cilostamide. Excised ovaries were punctured with 27 ga needles and cumulus enclosed oocytes were collected. The oocytes were mechanically denuded with a fine bore pipette and freed of cumulus and granulosa cells by serial dilutions. The denuded oocytes were rinsed twice in PBS, collected in 3 ul, and transferred to a microfuge tube. 30 ul of Trizol was added to each tube, which was vortexed for 5 seconds, then centrifuged briefly before snap freezing in liquid nitrogen and then stored at -70o. Mice (2325 days old) were injected IP with 5 IU of PMSG to stimulate follicle growth. Forty-four to forty eight hours later, animals were sacrificed and ovaries were excised
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.5 kb resulted in an average insert size of 1.0kb. This is a normalized library (primary library is NIH_MGC_256) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.


Name: NCI_CGAP_Ov43
Library ID: 1717
Organism: Mus musculus
Gender: female
Age: 0
Stage: juvenile
Organ: ovary
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 2.068 kb. Library constructed by Life Technologies. Note: This is an NCI_CGAP library.


Name: NCI_CGAP_Ov44
Library ID: 1827
Organism: Mus musculus
Age: 0
Organ: ovary
Tissue: ovarym PMSG-treated
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.2 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Soares NMO1

Name: Soares NMO1
Library ID: 1684
Organism: Mus musculus
Gender: female
Age: 0
Organ: ovary
Tissue: 6 and 10 hours post-treatment with PMSG/hCG
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCAACAGTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

Soares NMO2

Name: Soares NMO2
Library ID: 1685
Organism: Mus musculus
Gender: female
Age: 0
Organ: ovary
Tissue: 24 hours post-treatment with PMSG/hCG
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCCTCTATTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

Amplified Melton mouse islets 1 MIS1-A

Name: Amplified Melton mouse islets 1 MIS1-A
Library ID: 1899
Organism: Mus musculus
Strain: ICR
Gender: male
Age: 0
Stage: adult
Organ: pancreas
Tissue: Islets of Langerhans, pooled
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 0.91 kb. Amplified once on solid support. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University)

Kaestner ngn3 -/-

Name: Kaestner ngn3 -/-
Library ID: 1935
Organism: Mus musculus
Strain: 129/Sv x CD-1
Age: 0
Stage: embryo
Organ: pancreas
Host: DH12S
Vector: pSPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The cDNAs were prepared with an oligo containing a NotI site, and SalI linkers were added to the ends. The inserts were cut with NotI before being cloned into the NotI-SalI sites in the vector. Tissue was obtained from Gerard Gradwohl (PNAS 97:1607-1611, 2000). Library was prepared by Catherine S. Lee.

Kaestner ngn3 wt

Name: Kaestner ngn3 wt
Library ID: 1934
Organism: Mus musculus
Strain: 129/Sv x CD-1
Age: 0
Stage: embryo
Organ: pancreas
Host: DH12S
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: The cDNAs were prepared with an oligo containing a NotI site, and SalI linkers were added to the ends. The inserts were cut with NotI before being cloned into the NotI-SalI sites in the vector. Tissue was obtained from Gerard Gradwohl (PNAS 97:1607-1611, 2000). Library was prepared by Catherine S. Lee.

Melton amplified mouse E10.5/12.5 pancreas 1

Name: Melton amplified mouse E10.5/12.5 pancreas 1
Library ID: 1900
Organism: Mus musculus
Strain: ICR
Gender: both
Age: 0
Stage: embryo
Organ: pancreas
Tissue: pancreatic bud, pooled
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.47 kb. Amplified once on solid support. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton amplified mouse E16.5 pancreas3 M16S1-A

Name: Melton amplified mouse E16.5 pancreas3 M16S1-A
Library ID: 1933
Organism: Mus musculus
Strain: ICR
Gender: both
Age: 0
Stage: embryo
Organ: pancreas
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.47 kb. Amplified once on solid support. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton mouse adult pancreas 1 MAZ1

Name: Melton mouse adult pancreas 1 MAZ1
Library ID: 1901
Organism: Mus musculus
Strain: ICR
Gender: male
Age: 0
Stage: adult
Organ: pancreas
Tissue: normal pancreas, pooled
Host: TOP10
Vector: pZERO-2
Vector type: plasmid
Insert digest: 5' XhoI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton mouse adult pancreas 2 MAZ2

Name: Melton mouse adult pancreas 2 MAZ2
Library ID: 1902
Organism: Mus musculus
Strain: ICR
Gender: male
Age: 0
Stage: adult
Organ: pancreas
Tissue: normal pancreas, pooled
Host: TOP10
Vector: pZERO-2
Vector type: plasmid
Insert digest: 5' XhoI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton mouse E10.5/12.5 pancreas

Name: Melton mouse E10.5/12.5 pancreas
Library ID: 1907
Organism: Mus musculus
Strain: ICR
Gender: both
Age: 0
Stage: embryo
Organ: pancreas
Tissue: pancreatic bud, pooled
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 0.91 kb. Primary library, unamplified. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University)

Melton mouse E16.5 pancreas library 2 M16B2

Name: Melton mouse E16.5 pancreas library 2 M16B2
Library ID: 1903
Organism: Mus musculus
Strain: ICR
Gender: both
Age: 0
Stage: embryo
Organ: pancreas
Tissue: pooled
Host: DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.06kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton mouse E16.5 pancreas M16Z1

Name: Melton mouse E16.5 pancreas M16Z1
Library ID: 1904
Organism: Mus musculus
Strain: ICR
Gender: both
Age: 0
Stage: embryo
Organ: pancreas
Tissue: pooled
Host: TOP10
Vector: pZERO-2
Vector type: plasmid
Insert digest: 5' XhoI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation; average insert size 1.2kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton mouse islets MIZ1

Name: Melton mouse islets MIZ1
Library ID: 1905
Organism: Mus musculus
Strain: ICR
Gender: male
Age: 0
Stage: adult
Organ: pancreas
Tissue: Islets of Langerhans, pooled
Host: TOP10
Vector: pZERO-2
Vector type: plasmid
Insert digest: 5' XhoI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.1kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton mouse newborn pancreas MNZ1

Name: Melton mouse newborn pancreas MNZ1
Library ID: 1906
Organism: Mus musculus
Strain: ICR
Gender: both
Age: 0
Stage: infant
Organ: pancreas
Tissue: pooled
Host: TOP10
Vector: pZERO-2
Vector type: plasmid
Insert digest: 5' XhoI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton normalized mixed mouse pancreas 1 N1-MMS1

Name: Melton normalized mixed mouse pancreas 1 N1-MMS1
Library ID: 1948
Organism: Mus musculus
Strain: ICR
Gender: both
Age: 0
Stage: mixed
Organ: pancreas
Tissue: pool of whole pancreas, pancreatic bud, Islets of Langerhans
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Five libraries representing EI0.5/12.5 pancreatic bud, E16.5 pancreas, newborn pancreas, adult pancreas, and adult islets of Langerhans were separately constructed using SuperScript Plasmid Library kit (Life Technologies). cDNA was made by oligo-dT priming using primer 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3' and size-selected by column fractionation. Cloning was accomplished via 5' linkers: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. Libraries were amplified once on solid support and plasmid DNA from each library was prepared and mixed in equal amounts. The mixed library DNA was normalized by method #4 from Bonaldo, Lennon, and Soares (1996 Genome Research 6:791-806); 0.5 microgram single-stranded mixed library plasmid DNA was mixed with 5 micrograms PCR product representing mixed library inserts and hybridized to an Ecot of 6. Single-stranded (unhybridized) plasmids were isolated by hydroxyapatite chromatography and used to make this library. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).


Name: NIH_MGC_137
Library ID: 1949
Organism: Mus musculus
Age: 0
Organ: pancreas
Tissue: pool of whole pancreas (14.5, 16.5 dpc, newborn and adult), pancreatic bud (10.5 and 12.5 dpc), Islets of Langerhans (adult)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library consists of a pool of clones rearrayed from the following libraries: Melton normalized mixed mouse pancreas 1 N1-MMS1, Amplified Melton mouse islets 1 MIS1-A, and Kaestner ngn3 wt. Clones rearrayed in the laboratory of K. Kaestner (University of Pennsylvania). Note: this is a NIH_MGC Library.


Name: NIH_MGC_138
Library ID: 1950
Organism: Mus musculus
Strain: ICR
Gender: both
Age: 0
Organ: pancreas
Tissue: normal pancreas, pooled (adult male, 16.5 dpc pooled both male and female, pooled postnatal day 1-4 male and female), Islets of Langerhans, pooled (adult male)
Host: TOP10
Vector: pZERO-2
Vector type: plasmid
Insert digest: 5' XhoI/NotI 3'
Stop Codon Status: without
Description: Library consists of a pool of clones rearrayed from the following libraries: Melton mouse adult pancreas 1 MAZ1, Melton mouse adult pancreas 2 MAZ2, Melton mouse E16.5 pancreas M16Z1, Melton mouse islets MIZ1, and Melton mouse newborn pancreas MNZ1. Clones rearrayed in the laboratory of K. Kaestner (University of Pennsylvania). Note: this is a NIH_MGC Library.


Name: NIH_MGC_139
Library ID: 1951
Organism: Mus musculus
Strain: ICR
Gender: both
Age: 0
Stage: embryo
Organ: pancreas
Tissue: pooled
Host: DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library consists of a pool of clones rearrayed from the following library: Melton mouse E16.5 pancreas library 2 M16B2. Clones rearrayed in the laboratory of K. Kaestner (University of Pennsylvania). Note: this is a NIH_MGC Library.


Name: NIH_MGC_140
Library ID: 1952
Organism: Mus musculus
Strain: 129/Sv x CD-1
Age: 0
Stage: embryo
Organ: pancreas
Host: DH12S
Vector: pSPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library consists of a pool of clones rearrayed from the following library: Kaestner ngn3 -/-. Clones rearrayed in the laboratory of K. Kaestner (University of Pennsylvania). Note: this is a NIH_MGC Library.


Name: NIH_MGC_166
Library ID: 1998
Organism: Mus musculus
Gender: female
Age: 0
Stage: adult
Organ: pituitary gland
Tissue: pituitary gland
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5'' -ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 2.05 kb (range 1.0-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.

Schiller AtT-20

Name: Schiller AtT-20
Library ID: 1281
Organism: Mus musculus
Age: 0
Organ: pituitary gland
Tissue: cell line AtT-20
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line AtT-20 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Schiller AtT-20, RESP18 induced

Name: Schiller AtT-20, RESP18 induced
Library ID: 1282
Organism: Mus musculus
Age: 0
Organ: pituitary gland
Tissue: cell line, AtT-20, RESP18 induced
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line AtT-20 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This cell line was engineered for inducible overexpression of RESP18 using the rTET system. Cells were induced such that RESP18 protein would traverse the ER to the Golgi and induce the RESP18-activated signaling pathway. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).


Name: NIH_MGC_203
Library ID: 2058
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: placental
Organ: placenta
Tissue: pool of 3 placentas from one mouse
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.3 kb. This primary, microquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_222) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.


Name: NIH_MGC_204
Library ID: 2059
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: placental
Organ: placenta
Tissue: pool of 3 placentas from one mouse
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.75kb resulted in an average insert size of 1.1 kb. This primary, nanoquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_223) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.


Name: NIH_MGC_222
Library ID: 2060
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: placental
Organ: placenta
Tissue: pool of 3 placentas from one mouse
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1 kb resulted in an average insert size of 1.5 kb. Library is not amplified. (Normalized version of this library is NIH_MGC_203.) Library constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC Library.


Name: NIH_MGC_223
Library ID: 2061
Organism: Mus musculus
Strain: C57BL/6
Age: 0
Stage: placental
Organ: placenta
Tissue: pool of 3 placentas from one mouse
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.75 kb resulted in an average insert size of 1.35 kb. Library was not amplified. (Normalized version of this library is NIH_MGC_204.) Library constructed by Express Genomics (Frederick, MD).

Soares 4NbMP13.5-14.5

Name: Soares 4NbMP13.5-14.5
Library ID: 252
Organism: Mus musculus
Strain: C57BL/6J
Age: 0
Stage: embryo
Organ: placenta
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from medial nasal process tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGAGAGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double- stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

Soares MPR0

Name: Soares MPR0
Library ID: 1878
Organism: Mus musculus
Gender: male
Age: 0
Stage: infant
Organ: prostate
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTATAGACGCCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library was also constructed, Soares NMPR0. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa).

Soares NMPR0

Name: Soares NMPR0
Library ID: 1879
Organism: Mus musculus
Gender: male
Age: 0
Stage: infant
Organ: prostate
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCTATAGACGCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. A non-normalized version of this library was also constructed, Soares MPR0. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa).


Name: NCI_CGAP_Skn2
Library ID: 1758
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: skin
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.96 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Stratagene mouse skin

Name: Stratagene mouse skin
Library ID: 288
Organism: Mus musculus
Strain: C57BL/6J
Gender: female
Age: 0
Stage: adult
Organ: skin
Tissue: pooled skin
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Whole skin from 11 week old C57BL/6 female mice. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Library ID: 1697
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: small intestine
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.63 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Barstead MPL-RB10

Name: Barstead MPL-RB10
Library ID: 1062
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: spleen
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGTCGACAAC 3' and 5' GTTGTCGACG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).


Name: NCI_CGAP_Sp2
Library ID: 1649
Organism: Mus musculus
Age: 0
Organ: spleen
Tissue: flow-sorted NK cells
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: mRNA made from flow-sorted NK cells, cDNA made by oligo-dT priming. Directionally cloned. Average insert size 1.5 kb. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Note: this is a NCI_CGAP Library.

Soares 3NbMS

Name: Soares 3NbMS
Library ID: 321
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: spleen
Tissue: pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTGTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Bertrand Jordan. Library went through three rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit+/Sca-1+) cDNA Library (Long 1)

Name: NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit+/Sca-1+) cDNA Library (Long 1)
Library ID: 2136
Organism: Mus musculus
Strain: C57BL/6NCr
Age: 0
Stage: juvenile
Organ: stem cell
Tissue: hematopoietic stem cell (Lin-/c-Kit+/Sca-1+)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA), Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 4.8 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.7 kb. The library was constructed by Yulan Piao.

NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit+/Sca-1+) cDNA Library (Long)

Name: NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit+/Sca-1+) cDNA Library (Long)
Library ID: 2013
Organism: Mus musculus
Strain: C57BL/6NCr
Age: 0
Stage: juvenile
Organ: stem cell
Tissue: hematopoietic stem cell (Lin-/c-Kit+/Sca-1+)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA) and Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 4.8 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.7 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit+/Sca-1-) cDNA Library (Long)

Name: NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit+/Sca-1-) cDNA Library (Long)
Library ID: 2012
Organism: Mus musculus
Strain: C57BL/6NCr
Age: 0
Stage: juvenile
Organ: stem cell
Tissue: hematopoietic stem cell (Lin-/c-Kit+/Sca-1-)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA) and Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2.4 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1+) cDNA Library (Long 1)

Name: NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1+) cDNA Library (Long 1)
Library ID: 2098
Organism: Mus musculus
Strain: C57BL/6NCr
Age: 0
Stage: juvenile
Organ: stem cell
Tissue: hematopoietic stem cell (Lin-/c-Kit-/Sca-1+)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH ( This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA), Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 1.1 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao.

NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1+) cDNA Library (Long)

Name: NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1+) cDNA Library (Long)
Library ID: 2014
Organism: Mus musculus
Strain: C57BL/6NCr
Age: 0
Stage: juvenile
Organ: stem cell
Tissue: hematopoietic stem cell (Lin-/c-Kit-/Sca-1+)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA) and Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 1.1 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1-) cDNA Library (Long)

Name: NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1-) cDNA Library (Long)
Library ID: 2015
Organism: Mus musculus
Strain: C57BL/6NCr
Age: 0
Stage: juvenile
Organ: stem cell
Tissue: hematopoietic stem cell (Lin-/c-Kit-/Sca-1-)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA) and Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 0.9 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.1 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Mesenchymal Stem Cell cDNA Library (Long 1)

Name: NIA Mouse Mesenchymal Stem Cell cDNA Library (Long 1)
Library ID: 2101
Organism: Mus musculus
Strain: C3H/He
Age: 0
Organ: stem cell
Tissue: mesenchymal stem cells
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH ( This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 2.2 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao.

NIA Mouse Mesenchymal Stem Cell cDNA Library (Long)

Name: NIA Mouse Mesenchymal Stem Cell cDNA Library (Long)
Library ID: 1993
Organism: Mus musculus
Strain: C3H/He
Age: 0
Organ: stem cell
Tissue: mesenchymal stem cells
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2.2 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Neural Stem Cell (Differentiated) cDNA Library (Long)

Name: NIA Mouse Neural Stem Cell (Differentiated) cDNA Library (Long)
Library ID: 1987
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: adult
Organ: stem cell
Tissue: Neural Stem Cell (Differentiated)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Angelo L. Vescovi (Institute for Stem Cell Research, Italy). Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Neural Stem Cell (Undifferentiated) cDNA Library (Long)

Name: NIA Mouse Neural Stem Cell (Undifferentiated) cDNA Library (Long)
Library ID: 1986
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: adult
Organ: stem cell
Tissue: Neural Stem Cell (Doublets)
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Angelo L. Vescovi (Institute for Stem Cell Research, Italy). Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 3.8 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

NIA Mouse Trophoblast Stem Cell cDNA Library (Long 1)

Name: NIA Mouse Trophoblast Stem Cell cDNA Library (Long 1)
Library ID: 2100
Organism: Mus musculus
Strain: B5/EGFP transgenic ICR
Age: 0
Stage: embryo
Organ: stem cell
Tissue: trophoblast stem cell
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH ( This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Dr. Janet Rossant and Tilo Kunath (Samuel Lunenfeld Research Institute, Canada). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 4 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.6 kb. The library was constructed by Yulan Piao.

NIA Mouse Trophoblast Stem Cell cDNA Library (Long)

Name: NIA Mouse Trophoblast Stem Cell cDNA Library (Long)
Library ID: 1995
Organism: Mus musculus
Strain: B5/EGFP transgenic ICR
Age: 0
Stage: embryo
Organ: stem cell
Tissue: trophoblast stem cell
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Janet Possant and Tilo Kunath (Samuel Lunenfeld Research Institute, Canada). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 4 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.6 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].


Name: NIH_MGC_149
Library ID: 2110
Organism: Mus musculus
Strain: C57BL/Ka-Thy1
Age: 0
Stage: embryo
Organ: stem cell
Tissue: early hematopoietic precursor cells, isolated from bone marrow
Host: DH10B
Vector: pCDNA3
Vector type: phagemid
Insert digest: BstXI
Stop Codon Status: without
Description: First-strand cDNA was primed with the oligo-dT primer 5'-AATTCGAGCGGCCGCT(30)VN-3' and a switch primer 5'-TACGGCTGCGAGAAGACGACAGAAGGG-3'. DNA was amplified by 26 cycles of PCR and then size selected for >0.5 kb. An aliquot was used to reamplify for 7 more cycles. The BstXI adaptor 5'-TACGGCTGCGAGAAGACGACAGAAGGG-3' was ligated at both ends and non-directionally cloned into the BstXI site of the pcDNAIII vector. Original library contained 7.5 million clones. Library constructed by Mike Clarke (University of Michigan). Note: this is a NIH_MGC library.


Name: NIH_MGC_150
Library ID: 2111
Organism: Mus musculus
Strain: C57BL/Ka-Thy1
Gender: both
Age: 0
Stage: adult
Organ: stem cell
Tissue: multipotent committed hematopoietic progenitor cells
Host: DH10B
Vector: pOTB7-3
Vector type: phagemid
Insert digest: 5' AscI/BstXI 3'
Stop Codon Status: without
Description: Cells were isolated by flow cytometry and RNA isolated in Trizol reagent. cDNA was obtained by reverse transcription using oligo-dT primer 5'-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV-3'and treated with ExoI. PCR was performed using a complementary 3' primer containing a BstXI site and a cap-switch 5' primer. The resulting cDNA was digested with BstXI and ligated to a BstXI adaptor 5'-AAAAAAAAAAAAAAAAGTCGACATCGATACGCGTGGTCTCGTAGCTGACTTTCCAGCACA-3' then digested with AscI. Size-selection was performed >0.5 kb to result in an average insert size of 0.7 kb. Library constructed and contributed by Mike Clarke and Andrew Hass (University of Michigan). Note: this is an MGC library.


Name: NIH_MGC_196
Library ID: 2044
Organism: Mus musculus
Strain: 129/Sv
Age: 0
Stage: embryo
Organ: stem cell
Tissue: Embryonic Stem cells
Host: DH10B TonA
Vector: pCI-neo (updated)
Vector type: plasmid
Insert digest: 5' AscI/PacI 3'
Stop Codon Status: without
Description: Constructed by Gina Zastrow using the Bradfield Laboratory RACE method University of Wisconsin). Note: this is a NIH_MGC library.


Name: NCI_CGAP_St1
Library ID: 1759
Organism: Mus musculus
Gender: female
Age: 0
Stage: juvenile
Organ: stomach
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.77 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_426
Library ID: 2482
Organism: Mus musculus
Age: 0
Organ: synthesized DNA
Host: DH10B TonA
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: with
Description: DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TAAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Clones were synthesized by GENEART AG (Regensburg, Germany). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.


Name: NIH_MGC_427
Library ID: 2483
Organism: Mus musculus
Age: 0
Organ: synthesized DNA
Host: DH10B TonA
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without
Description: DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TCAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Clones were synthesized by GENEART AG (Regensburg, Germany). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.


Name: NIH_MGC_436
Library ID: 2492
Organism: Mus musculus
Age: 0
Organ: synthesized DNA
Host: DH10B TonA
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: with
Description: DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TAAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Clones were synthesized by Codon Devices (Cambridge, MA). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.


Name: NIH_MGC_482
Library ID: 2509
Organism: Mus musculus
Age: 0
Organ: synthesized DNA
Host: DH10B
Vector: pSMART_cDNA
Vector type: plasmid
Insert digest: multiple
Stop Codon Status: with


Name: NIH_MGC_483
Library ID: 2511
Organism: Mus musculus
Age: 0
Organ: synthesized DNA
Host: DH10B
Vector: pUC19-Kan
Vector type: plasmid
Insert digest: multiple
Stop Codon Status: with


Name: NIH_MGC_484
Library ID: 2510
Organism: Mus musculus
Age: 0
Organ: synthesized DNA
Host: DH10B
Vector: pUC19
Vector type: plasmid
Insert digest: multiple
Stop Codon Status: with


Name: NIH_MGC_488
Library ID: 2513
Organism: Mus musculus
Age: 0
Organ: synthesized DNA
Host: DH10B
Vector: pUC19-Sfi
Vector type: plasmid
Insert digest: multiple
Stop Codon Status: without

Stratagene mouse T-cell (937311)

Name: Stratagene mouse T-cell (937311)
Library ID: 286
Organism: Mus musculus
Age: 0
Stage: adult
Organ: T-cell
Tissue: M30 CD4+
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. M30 CD4+ cells. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Barstead MPL-RB11

Name: Barstead MPL-RB11
Library ID: 1063
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGTCGACTTC 3' and 5' GAAGTCGACG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Barstead MPL-RB15

Name: Barstead MPL-RB15
Library ID: 1315
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: testis
Tissue: pachytene spermatocyte
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [5' AATTCACTAGTTTT 3' and 5' AAAACTAGTG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Barstead MPL-RB16

Name: Barstead MPL-RB16
Library ID: 1327
Organism: Mus musculus
Gender: male
Age: 0
Organ: testis
Tissue: mid-pachytene stage spermatids
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without

McCarrey/Eddy 18-20 day sertoli cell

Name: McCarrey/Eddy 18-20 day sertoli cell
Library ID: 1638
Organism: Mus musculus
Gender: male
Age: 0
Organ: testis
Tissue: 18-20 day sertoli cells
Host: GeneHogs DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

McCarrey/Eddy 18-day leptotene and zygotene spermatocytes

Name: McCarrey/Eddy 18-day leptotene and zygotene spermatocytes
Library ID: 1635
Organism: Mus musculus
Gender: male
Age: 0
Organ: testis
Tissue: 18-day leptotene and zygotene spermatocytes
Host: GeneHogs DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

McCarrey/Eddy 18-day preleptotene spermatocytes

Name: McCarrey/Eddy 18-day preleptotene spermatocytes
Library ID: 1634
Organism: Mus musculus
Gender: male
Age: 0
Organ: testis
Tissue: 18-day preleptotene spermatocytes
Host: GeneHogs DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

McCarrey/Eddy 6-day primitive type A spermatogonia

Name: McCarrey/Eddy 6-day primitive type A spermatogonia
Library ID: 1636
Organism: Mus musculus
Gender: male
Age: 0
Organ: testis
Tissue: 6-day primitive type A spermatogonia
Host: GeneHogs DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

McCarrey/Eddy adult testis

Name: McCarrey/Eddy adult testis
Library ID: 1637
Organism: Mus musculus
Strain: 129/Sv
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: GeneHogs DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

McCarrey/Eddy round spermatid

Name: McCarrey/Eddy round spermatid
Library ID: 1598
Organism: Mus musculus
Strain: CD-1
Gender: male
Age: 0
Stage: adult
Organ: testis
Tissue: round spermatids, pooled from multiple mice
Host: GeneHogs DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library contains 98.5% recombinants. References: J. Androl. 20:635-639 and Gene 25:263-269. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences). Original lambda-based library is available through ATCC, catalog #63423.

McCarrey/Eddy spermatocytes

Name: McCarrey/Eddy spermatocytes
Library ID: 1597
Organism: Mus musculus
Strain: CD-1
Gender: male
Age: 0
Stage: adult
Organ: testis
Tissue: pachytene spermatocytes, pooled from multiple mice
Host: GeneHogs DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library contains 98% recombinants. References: J. Androl. 20:635-639 and Gene 25:263-269. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences). Original lambda-based library is available through ATCC, catalog #63422.

McCarrey/Eddy type A spermatogonia

Name: McCarrey/Eddy type A spermatogonia
Library ID: 1595
Organism: Mus musculus
Strain: CD-1
Gender: male
Age: 0
Stage: juvenile
Organ: testis
Tissue: type A spermatogonia, pooled from multiple mice
Host: GeneHogs DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library contains 96.5% recombinants. References: J. Androl. 20:635-639 and Gene 25:263-269. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences). Original lambda-based library is available through ATCC, catalog #63416.

McCarrey/Eddy type B spermatogonia

Name: McCarrey/Eddy type B spermatogonia
Library ID: 1596
Organism: Mus musculus
Strain: CD-1
Gender: male
Age: 0
Stage: juvenile
Organ: testis
Tissue: type B spermatogonia, pooled from multiple mice
Host: GeneHogs DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library contains 96% recombinants. References: J. Androl. 20:635-639 and Gene 25:263-269. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences). Original lambda-based library is available through ATCC, catalog #63417.


Name: NCI_CGAP_Te1
Library ID: 1630
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_165
Library ID: 2005
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: juvenile
Organ: testis
Tissue: primary cultures of Sertoli cells isolated from testis
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C or G and N = A, C, G or T). Average insert size 1.4 kb (range 0.6-3.5 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_169
Library ID: 1965
Organism: Mus musculus
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5 kb size fraction. Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library.


Name: NIH_MGC_381
Library ID: 2396
Organism: Mus musculus
Gender: male
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_382 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_382
Library ID: 2397
Organism: Mus musculus
Gender: male
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_381 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_383
Library ID: 2398
Organism: Mus musculus
Gender: male
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_384 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_384
Library ID: 2399
Organism: Mus musculus
Gender: male
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_383 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Stratagene mouse testes

Name: Stratagene mouse testes
Library ID: 285
Organism: Mus musculus
Strain: CD-1
Age: 0
Stage: adult
Organ: testis
Tissue: mixed germ cells
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Name: NIH_MGC_385
Library ID: 2400
Organism: Mus musculus
Age: 0
Organ: thymus
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_386 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_386
Library ID: 2401
Organism: Mus musculus
Age: 0
Organ: thymus
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_385 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_387
Library ID: 2402
Organism: Mus musculus
Age: 0
Organ: thymus
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_388 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_388
Library ID: 2403
Organism: Mus musculus
Age: 0
Organ: thymus
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_387 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Ren/Stubbs mouse thymus

Name: Ren/Stubbs mouse thymus
Library ID: 1407
Organism: Mus musculus
Strain: C3H
Gender: both
Age: 0
Stage: juvenile
Organ: thymus
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' NotI/PacI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer;double-stranded cDNA was ligated using 5' linker ggccgctat and 3' linker aactggaagcttaatt. Library is size-selected 2.5 kb and average insert size is 3.5 kb. Clones were arrayed from primary plating; non-amplified. Library constructed by X. Ren and L. Stubbs (Lawrence Livermore National Laboratory and DOE Joint Genome Institute, 7000 East Ave, L-453, Livermore, CA 94550).

Soares 2NbMT

Name: Soares 2NbMT
Library ID: 320
Organism: Mus musculus
Strain: C57BL/6
Gender: male
Age: 0
Stage: adult
Organ: thymus
Tissue: pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Bertrand Jordan. Library went through two rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.


Name: NIH_MGC_189
Library ID: 2133
Organism: Mus musculus
Strain: wild type
Gender: both
Age: 0
Stage: juvenile
Organ: thyroid
Tissue: 5 pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from 5 normal wild-type mice. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.2 kb. This primary, nanoquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_230) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library


Name: NIH_MGC_230
Library ID: 2134
Organism: Mus musculus
Strain: wild type
Gender: both
Age: 0
Stage: juvenile
Organ: thyroid
Tissue: 5 pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from 5 normal wild-type mice thyroid. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.2 kb. Normalized version of this library is NIH_MGC_189ibrary constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC Library.


Name: NIH_MGC_190
Library ID: 2040
Organism: Mus musculus
Strain: ICR
Age: 0
Stage: infant
Organ: tooth
Tissue: pooled molar
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5'' -ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.71 kb (range 0.5-3.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.

Yamada E19.5 molar

Name: Yamada E19.5 molar
Library ID: 1319
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: tooth
Tissue: molar
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without

Soares NMTC

Name: Soares NMTC
Library ID: 1681
Organism: Mus musculus
Age: 0
Organ: trophoblast
Tissue: trophoblast cells
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGGTTGTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).


Name: NCI_CGAP_Ut8
Library ID: 1716
Organism: Mus musculus
Gender: female
Age: 0
Stage: juvenile
Organ: uterus
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.616 kb. Library constructed by Life Technologies. Note: This is an NCI_CGAP library.

Soares NMPu

Name: Soares NMPu
Library ID: 741
Organism: Mus musculus
Strain: C57BL/6
Gender: female
Age: 0
Stage: adult
Organ: uterus
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTATCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Library was constructed by Bento Soares and M. Fatima Bonaldo.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
Email address:
Biological Questions and Comments to