Notice: Undefined variable: vectorID_where_clause in /var/www/html/image/image.php on line 1427 Vectors
Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

Vectors

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |


Login...

1. Lafmid BA
2. pAD-GAL4
3. pAMP1
4. pAMP10
5. pBC SK+
6. pBK-CMV
7. pBluescribe (modified)
8. pBluescript (modified)
9. pBluescript II KS+
10. pBluescript II SK+
11. pBluescript KS+
12. pBluescript SK+
13. pBluescript SK-
14. pBluescript-FL
15. pBluescriptR
16. pBSRN3
17. pCDNA3
18. pcDNA3.1
19. pcDNA3.1(-)
20. pcDNA3.1Zeo
21. pcDNAI
22. pCDNAII
23. pCI-neo (updated)
24. pCMV-SPORT
25. pCMV-SPORT2
26. pCMV-SPORT4
27. pCMV-SPORT6
28. pCMV-SPORT6.1
29. pCMV-SPORT6.ccdb
30. pCR-BluntII-TOPO
31. pCR-XL-TOPO
32. pCR2.1-TOPO
33. pCR3.1
34. pCR4-TOPO
35. pCR4Blunt-TOPO
36. pCS105
37. pCS107
38. pCS108
39. pCS111
40. pCS2+
41. pCS22+
42. pCS2G
43. pDeliver1.1
44. pDNR-Dual
45. pDNR-LIB
46. pDNR-NCI
47. pDONR201
48. pDONR223
49. pENTR/D-TOPO
50. pENTR201
51. pENTR221
52. pENTR223
53. pENTR223.1
54. pENTR223.1-LC
55. pENTR223.1-Sfi
56. pET-28a
57. pET-28b
58. pExpress-1
59. pFLC1
60. pGA1
61. pGA14
62. pGA15
63. pGA18
64. pGA19
65. pGA24
66. pGA4
67. pGA7
68. pGH
69. pMA
70. pME18S-FL3
71. pMK
72. pMK-U
73. pOTB7
74. pOTB7-3
75. pOTB7a
76. pPCR-Script Amp SK(+)
77. pRKW2
78. pSMART_cDNA
79. pSPORT1
80. pSPORT2
81. pT7T3D-PacI
82. pUC19
83. pUC19-Cam
84. pUC19-Kan
85. pUC19-Sfi
86. pUC57
87. pYX-Asc
88. pZERO-2
89. pZL-1

Note: The sequencing primers listed below for each vector are not exhaustive (only the most commonly used primers have been checked, -21M13, M13 reverse, t7, t3, and sp6) and others not listed may also be suitable. We also recommend that you check the exact sequence of your primer against the vector sequence to ensure that it matches, as there are often several slightly different versions of these common primers. When custom primers are required, their sequences are listed.


Lafmid BA

Name: Lafmid BA
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Columbia University/Soares
Vector type: phagemid
Vector Map: Available Here
Comments: FLANKING PCR PRIMERS: ab1: gaattgtgagcggataac ab2: gttttcccagtcacgacg or dm1: agctatgaccatgattacgcca dm2: gacggccagtgaattcccct. Annealing Temp: 55C
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:
taacaatttcacacaggaaacagctatgaccatgattacgccaagcttgg
ctcgacggatccccttgcggccgcaaggggaattccactggccgtcgttt
tacaacgtcgtgactgggaaaaccc

Full Sequence:

pAD-GAL4

Name: pAD-GAL4
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Polylinker Sequence:
ccaaacccaaaaaaagagatcgaattcgcccgggcctcgagcccgggtcg
actctagagccctatagtgagtcgtattactgcagagatctatgaatcgt
agatactgaaaaac


pAMP1

Name: pAMP1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacg
acggccagtgaattgaatttaggtgacactatagaagagctatgacgtcg
catgcacgcgtacgtaagcttggatcctctagagcggccgcctactacta
ctaatgatgatgatgcccgggaattccggaccggtacctgcaggcgtacc
agctttccctatagtgagtcgtattagagcttggcgtaatcatggtcata
gctgtttcctgtgtgaaattgttatccgctcacaattccacaca

Full Sequence:

pAMP10

Name: pAMP10
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
cccagtcacgacgttgtaaaacgacggccagtgaattgaatttaggtgac
actatagaagagctatgacgtcgcatgcacgcgtacgtaagcttggatcc
tctagagcggccggccgcctactactactaatgatgatgatgtcgacccg
ggaattccggaccggtacctgcaggcgtaccagctttccctatagtgagt
cgtattagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaat
tgttatc

Full Sequence:

pBC SK+

Name: pBC SK+
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCG
AATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGAT
ATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCAC
CGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGC
TTGGCGTAATCATGGTCATAGCTGTTTCC

Full Sequence:

pBK-CMV

Name: pBK-CMV
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Stratagene
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
aaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttc
ccagtcacgacgttgtaaaacgacggccagtgaattgtaatacgactcac
tatagggcgaattgggtacacttacctggtaccccacccgggtggaaaat
cgatgggcccgcggccgctctagaagtactctcgagaagctttttgaatt
ctttggatccactagtgtcgacctgcaggcgcgcgagctccagcttttgt
tccctttagtgagggttaatttcgagcttggcgtaatcaaggtcatagct
gtttcctgtgtgaaattgttatccgctcacaattccacacaatatacgag
ccggaagtataaagtgtaaagcctggggtgccta

Full Sequence:

pBluescribe (modified)

Name: pBluescribe (modified)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Jackson Laboratory
Vector type: phagemid
Vector Map: Available Here
Comments: Stratagene vector modified by Knowles/Solter (Jackson Laboratory): original EcoRI site changed to MluI, original HindIII site changed to SalI.
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
taatacgactcactatagggatcactatagggcgaattgacgcgtg...5
' end of insert (Knowles/Solter
libraries).........3' end of
insert...gtcgaccggagcttttgttccctttagtgagggttaat

Full Sequence:

pBluescript (modified)

Name: pBluescript (modified)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCLA/Lin
Vector type: phagemid
Comments: custom modification from original Stratagene vector
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
ttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcg
aattgggtaccgggccccccctcgaggtcgacggtatcgataagcttgat
atcgaattccactgcgtgctgcgcccgggggatccgcatgccacactgtg
tctagagcggccgccaccgcggtggagctccagttttgttccctttagtg
agggttaattgcgcgcttggcgtaatcatggtcatagctgtttcc


pBluescript II KS+

Name: pBluescript II KS+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
ggaaacagctatgaccatgattacgccaagctcgaaattaaccctcacta
aagggaacaaaagctggagctccaccgcggtggcggccgctctagaacta
gtggatcccccgggctgcaggaattcgatatcaagcttatcgataccgtc
gacctcgagggggggcccggtacccaattcgccctatagtgagtcgtatt
acaattcactggccgtcgttttacaa

Full Sequence:

pBluescript II SK+

Name: pBluescript II SK+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
GCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCT
ACAGGGCGCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGC
GATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGT
GCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACG
TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCG
AATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGAT
ATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCAC
CGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGC
TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCT
CACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGG
GTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCC
GCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCA
ACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGC
TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCT
CACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGC

Full Sequence:

pBluescript KS+

Name: pBluescript KS+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
CGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCT
GCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTG
TAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAAT
TGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGG
CTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGG
GCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTG
GCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCAC
AATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTG
CCTAATGAGTGAGCTA

Full Sequence:

pBluescript SK+

Name: pBluescript SK+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
ggaaacagctatgaccatgattacgccaagctcgaaattaaccctcacta
aagggaacaaaagctggagctccaccgcggtggcggccgctctagaacta
gtggatcccccgggctgcaggaattcgatatcaagcttatcgataccgtc
gacctcgagggggggcccggtacccaattcgccctatagtgagtcgtatt
acaattcactggccgtcgttttacaa

Full Sequence:

pBluescript SK-

Name: pBluescript SK-
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
ggaaacagctatgaccatgattacgccaagctcgaaattaaccctcacta
aagggaacaaaagctggagctccaccgcggtggcggccgctctagaacta
gtggatcccccgggctgcaggaattcgatatcaagcttatcgataccgtc
gacctcgagggggggcccggtacccaattcgccctatagtgagtcgtatt
acaattcactggccgtcgttttacaa

Full Sequence:

pBluescript-FL

Name: pBluescript-FL
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: University of Tokyo/Sugano lab
Vector type: phagemid
Has Custom Primer: yes
Vector Map: Available Here
Comments: NOTE [previously located in "full_seq" table]: the polylinker sequence above replaces the following sequence in pBluescript: actagtggatcccccgggctgcag
Sequencing Primers: t7, t3
Polylinker Sequence:
actagtggatccattgtttggccttgttggccatcatttgggctgcag
Full Sequence:

pBluescriptR

Name: pBluescriptR
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Brownstein
Vector type: phagemid
Vector Map: Available Here
Comments: modified pBluescript from Riken.
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
tgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaa
agggggatgtgctgcaaggcgattaagttgggtaacgccagggttttccc
agtcacgacgttgtaaaacgacggccagtgaattgtaatacgactcacta
tagggcgaattggagctccaccgcggtggcggccgcataacttcgtatag
catacattatacgaagttatggatcaggccaaatcggccgagctcgaatt
cgtcgag----5'-insert-3'----ggatccggccataagggcctgat
ccgtcgagggggggcccggtaccagcttttgttccctttagtgagggtta
atttcgagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattg
ttatccgctcacaattccacacaacatacgagccggaagcataaagtgta
aagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgc
tcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatg
aatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccg
cttcctcgctcactgactcgctgcgctcgg

Full Sequence:

pBSRN3

Name: pBSRN3
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Wellcome Trust
Vector type: plasmid
Has Custom Primer: yes
Comments: modified pBluescript KS+, REFERENCE: Lemaire, et al., Cell (1995) 81(1)85-94.
Polylinker Sequence:
gagctaagcttgcttgttctttttgcagaagctcagaataaacgctcaac
tttggcagatctgaattccccggggcggccgcggatctggttaccactaa
accagcctcaagaacacccgaatggagtctctaagctacataataccaac
ttacactttacaaaatgttgtcccccaaaatgtagccattcgtatctgct
cctaataaaaagaaagtttcttcacttctaaaaa


pCDNA3

Name: pCDNA3
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Polylinker Sequence:
ATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTA
CGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTT
ACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGAC
GTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATT
GACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACAT
CAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAA
ATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTA
CTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGG
TTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATT
TCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAA
ATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAA
ATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTG
GCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTC
ACTATAGGGAGACCCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGG
CCGCCAGTGTGCTGGAATTCTGCAGATATCCATCACACTGGCGGCCGCTC
GAGCATGCATCTAGAGGGCCCTATTCTATAGTGTCACCTAAATGCTAGAG
CTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTT
TGCCCCTCCCCCGTGCC

Full Sequence:

pcDNA3.1

Name: pcDNA3.1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Sequencing Primers: t7, sp6
Polylinker Sequence:
agtacatcaatgggcgtggatagcggtttgactcacggggatttccaagt
ctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacg
ggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcg
gtaggcgtgtacggtgggaggtctatataagcagagctctctggctaact
agagaacccactgcttactggcttatcgaaattaatacgactcactatag
ggagacccaagcttggtaccgagctcggatccactagtaacggccgccag
tgtgctggaattctgcagatatccatcacactggcggccgctcgagcatg
catctagagggccctattctatagtgtcacctaaatgctagagctcgctg
atcagcctcgactgtgcctctagttgccagccatctgttgtttgcccctc
ccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcct
aataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctatt
ctggggggtggggtggggcaggacagcaagggggaggattgggaagacaa
tagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaa
gaaccagctggggctctagggggtatccccacgcgccctgtagcggcgca
ttaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgc
cagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgcca
cgttcgccggctttccccgtcaagctctaaatcggggca

Full Sequence:

pcDNA3.1(-)

Name: pcDNA3.1(-)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13 reverse, t7
Polylinker Sequence:
atgtacgggccagatatacgcgttgacattgattattgactagttattaa
tagtaatcaattacggggtcattagttcatagcccatatatggagttccg
cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacc
cccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaata
gggactttccattgacgtcaatgggtggagtatttacggtaaactgccca
cttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacg
tcaatgacggtaaatggcccgcctggcattatgcccagtacatgacctta
tgggactttcctacttggcagtacatctacgtattagtcatcgctattac
catggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttg
actcacggggatttccaagtctccaccccattgacgtcaatgggagtttg
ttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgc
cccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataa
gcagagctctctggctaactagagaacccactgcttactggcttatcgaa
attaatacgactcactatagggagacccaagctggctagcgtttaaacgg
gccctctagactcgagcggccgccactgtgctggatatctgcagaattcc
accacactggactagtggatccgagctcggtaccaagcttaagtttaaac
cgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttg
cccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcc
tttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcat
tctattctggggggtggggtggggcaggacagcaagggggaggattggga
agacaatagcaggcatgctggggatgcggtgggctctatggcttctgagg

Full Sequence:

pcDNA3.1Zeo

Name: pcDNA3.1Zeo
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13 reverse, t7
Polylinker Sequence:
cccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagt
aacgccaatagggactttccattgacgtcaatgggtggactatttacggt
aaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccc
cctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagta
catgaccttatgggactttcctacttggcagtacatctacgtattagtca
tcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtgga
tagcggtttgactcacggggatttccaagtctccaccccattgacgtcaa
tgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgta
acaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggag
gtctatataagcagagctctctggctaactagagaacccactgcttactg
gcttatcgaaattaatacgactcactatagggagacccaagctggctagc
gtttaaacttaagcttggtaccgagctcggatccactagtccagtgtggt
ggaattctgcagatatccagcacagtggcggccgctcgagtctagagggc
ccgtttaaacccgctgatcagcctcgactgtgccttctagttgccagcca
tctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccac
tcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctga

Full Sequence:

pcDNAI

Name: pcDNAI
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: t7, sp6
Polylinker Sequence:
acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaa
tgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacg
gtgggaggtctatataagcagagctctctggctaactagagaacccactg
cttactggcttatcgaaattaatacgactcactatagggagacccaagct
tggtaccgagctcggatccactagtaacggccgccagtgtgctggaattc
tgcagatatccatcacactggcggccgctcgagcatgcatctagagggcc
ctattctatagtgtcacctaaatgctagaggatctttgtgaaggaacctt
acttctgtggtgtgacataattggacaaactacctacagagatttaaagc

Full Sequence:

pCDNAII

Name: pCDNAII
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
ccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgc
cagggttttcccagtcacgacgttgtaaaacgacggccagtgaattgtaa
tacgactcactatagggcgaattgggccctctagatgcatgctcgagcgg
ccgccagtgtgatggatatctgcagaattccagcacactggcggccgtta
ctagtggatccgagctcggtaccaagcttgatgcatagcttgagtattct
atagtgtcacctaaatagcttggcgtaatcatggtcatagctgtttcctg
tgtgaaattgtt

Full Sequence:

pCI-neo (updated)

Name: pCI-neo (updated)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: McArdle Laboratory for Cancer Research
Vector type: plasmid
Has Custom Primer: yes
Sequencing Primers: t3, custom t7
Polylinker Sequence:
tgcagaagttggtcgtgaggcactgggcaggtaagtatcaaggttacaag
acaggtttaaggagaccaatagaaactgggcttgtcgagacagagaagac
tcttgcgtttctgataggcacctattggtcttactgacatgtccactccc
agttcaattacagctcttaaggctagagtacttaatacgactcactatag
gctagcggcgcgccgaattcgtcgacttaattaagcggccgcttcccttt
agtgagggttaatgcttcgagcagacatgataagatacattgatgagttt
ggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaat
ttgtgatgctattgctttatttgtaaccattataagctgcaataaacaag
ttaacaacaacaattgcattcattttatgtttcaggttcagggggagatg
tgggaggttttttaaagcaagt


pCMV-SPORT

Name: pCMV-SPORT
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: An MluI site is introduced upon ligation of a cDNA insert.
Sequencing Primers: t7, sp6
Polylinker Sequence:
taatacgactcactatagggagagagctatgacgtcgcatgcacgcgtaa
gcttgggcccctcgagggatcctctagagcggccgc{3' - cDNA
insert -
5'}cggACGCGTgggtcgacccgggaattccggaccggtacctgcaggcg
taccttctatagtgtcacctaaatagctttttgcaaaagcctaggctaga
gtccggagg{CMV Promoter}

Full Sequence:

pCMV-SPORT2

Name: pCMV-SPORT2
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: An MluI site is introduced upon ligation of a cDNA insert.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gacgttgtaaaacgacggccagtgcctagcttataatacgactcactata
gggagagagctatgacgtcgcatgcacgcgtaagcttgggcccctcgagg
gatcctctagagcggccgc{3' - cDNA insert -
5'}cggACGCGTgggtcgacccgggaattccggaccggtacctgcaggcg
taccttctatagtgtcacctaaatagctttttgcaaaagcctagtggtca
tagctgtttcctgtgtgaaattgttatccgctccgcggcctaggctagag
tcc{CMV Promoter}

Full Sequence:

pCMV-SPORT4

Name: pCMV-SPORT4
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: An MluI site is introduced upon ligation of a cDNA insert.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gacgttgtaaaacgacggccagtgcctagcttataatacgactcactata
gggagagagctatgacgtcgcatgcacgcgtaagcttgggcccctcgagg
gatcctctagagcggccgc{3' - cDNA insert -
5'}cggACGCGTgggtcgacccgggaattccggaccggtacctgcaggcg
taccttctatagtgtcacctaaatagctttttgcaaaagcctagtggtca
tagctgtttcctgtgtgaaattgttatccgctccgcggcctaggctagag
tcc{CMV Promoter}

Full Sequence:

pCMV-SPORT6

Name: pCMV-SPORT6
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: An MluI site is introduced upon ligation of a cDNA insert.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gatcccaagctagcagttttcccagtcacgacgttgtaaaacgacggcca
gtgcctagcttataatacgactcactatagggaccactttgtacaagaaa
gctgggtacgcgtaagcttgggcccctcgagggatactctagagcggccg
ccgactagtgagctcgtcgacgatatcccgggaattccggaccggtacca
gcctgcttttttgtacaaacttgttctatagtgtcacctaaataggccta
atggtcatagctgtttcctgtgtgaaatt

Full Sequence:

pCMV-SPORT6.1

Name: pCMV-SPORT6.1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: also known as pCMV-SPORT6.1.ccdb
Sequencing Primers: M13(-21), M13 reverse, sp6
Polylinker Sequence:
caccacagaagtaaggttccttcacaaagatcccaagctagcagttttcc
cagtcacgacgttgtaaaacgacggccagtgcctagcttataatacgact
cactatagggaccactttgtacaagaaagctgggtacgcgtaagcttggg
cccctcgagggatactctagagcggccgccgatccggcttactaaaagcc
agataacagtatgcgtatttgcgcgctgatttttgcggtataagaatata
tactgatatgtatacccgaagtatgtcaaaaagaggtgtgcttctagaat
gcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttg
tggatgtacagagtgatattattgacacgcccgggcgacggatggtgatc
cccctggccagtgcacgtctgctgtcagataaagtctcccgtgaacttta
cccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgata
tggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagc
caccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaat
ataagtcgacgatatcccgggaattccggaccggtaccagcctgcttttt
tgtacaaacttgttctatagtgtcacctaaataggcctaatggtcatagc
tgtttcctgtgtgaaattgttatccgctccgcggcctaggctagagtccg
gaggctggatcggtcccggtgtcttctatggaggtcaaaacag

Full Sequence:

pCMV-SPORT6.ccdb

Name: pCMV-SPORT6.ccdb
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: for microquantity libraries
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
cactatagggaccactttgtacaagaaagctgggtacgcgtaagcttggg
cccctcgagggatcctctagagcggccgccgatccggcttactaaaagcc
agataacagtatgcgtatttgcgcgctgatttttgcggtataagaatata
tactgatatgtatacccgaagtatgtcaaaaagaggtgtgcttctagaat
gcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttg
tggatgtacagagtgatattattgacacgcccgggcgacggatggtgatc
cccctggccagtgcacgtctgctgtcagataaagtctcccgtgaacttta
cccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgata
tggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagc
caccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaat
ataagtcgacgatatcccgggaattccggaccggtaccagcctgcttttt
tgtacaaacttgttctatagtgtcacctaaataggcctaatggtcatagc
tgtttcctgtgtgaaattgttatccgctccgcggcctaggctagagtccg

Full Sequence:

pCR-BluntII-TOPO

Name: pCR-BluntII-TOPO
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: PCR cloning vector, cloning site between the EcoRI sites (capitalized) as follows: GAATTCgccctt--cDNA INSERT--agggcGAATTC.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
acagctatgaccatgattacgccaagctatttaggtgacactatagaata
ctcaagctatgcatcaagcttggtaccgagctcggatccactagtaacgg
ccgccagtgtgctggaattcgcccttaagggcgaattctgcagatatcca
tcacactggcggccgctcgagcatgcatctagagggcccaattcgcccta
tagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgact
gggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccct
ttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttccca
acagttgcgcagcctatacgtacggcagtttaaggtttacacctataaaa
gagagagccgttatcgtctgtttgtggatgtacagagtgatattattgac
acgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtc
agataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaa
gctggcgcat

Full Sequence:

pCR-XL-TOPO

Name: pCR-XL-TOPO
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: this vector has both kanamycin and zeocin resistance
Sequencing Primers: M13(-21), M13 reverse, t7
Polylinker Sequence:
CACACAGGAAACAGCTATGACCATGATTACGCCAAGCTATTTAGGTGACG
CGTTAGAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGATCCA
CTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTAAGGGCGAATTCTG
CAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCA
ATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAA
CGTCGTGACTGGGAAAACCCTGGCGT

Full Sequence:

pCR2.1-TOPO

Name: pCR2.1-TOPO
Antibiotic: ampicillin
Concentration: 100 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: PCR cloning vector, cloning site between the EcoRI sites (capitalized) as follows: GAATTCgccctt--cDNA INSERT--agggcGAATTC.
Sequencing Primers: M13(-21), M13 reverse, t7
Polylinker Sequence:
cacacaggaaacagctatgaccatgattacgccaagcttggtaccgagct
cggatccactagtaacggccgccagtgtgctggaattcgcccttaagggc
gaattctgcagatatccatcacactggcggccgctcgagcatgcatctag
agggcccaattcgccctatagtgagtcgtattacaattcactggccgtcg
ttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgc
cttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccg
caccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacg

Full Sequence:

pCR3.1

Name: pCR3.1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Polylinker Sequence:
tcgaaattaatacgactcactatagggagacccaagctggctagcgttta
aacttaagcttggtaccgagctcggatccactagtccagtgtggtggaat
tcggcttaagccgaattctgcagatatccagcacagtggcggccgctcga
gtctagagggcccgtttaaacccgctgatcagcctcgactgtgccttcta
gttgccagcc

Full Sequence:

pCR4-TOPO

Name: pCR4-TOPO
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: this vector has both ampicillin and kanamycin-resistance
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
GCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCAC
GACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGT
GAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGG
CTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAAC
AGCTATGACCATGATTACGCCAAGCTCAGAATTAACCCTCACTAAAGGGA
CTAGTCCTGCAGGTTTAAACGAATTCGCCCTTAAGGGCGAATTCGCGGCC
GCTAAATTCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGT
CGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATC
GCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCC
CGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTATACGTACGGCAGTT
TAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATG
TACAGAGTGATATTATTGACACGCCGGGGCGACGGATGGTGATCCCCCTG
GCCAGTGCACGTCTGCTG

Full Sequence:

pCR4Blunt-TOPO

Name: pCR4Blunt-TOPO
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: This vector has both kanamycin and ampicillin resistance
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pCS105

Name: pCS105
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Comments: vector size 4.1 kb
Polylinker Sequence:
cgccattctgcctggggacgtcggagcaagcttgatttaggtgacactat
agaatacaagctacttgttctttttgcaggatcccatcgattcgaattcg
tcgacaggccaatctggccgcggccgcaaggcctctcgagcctctagaac
tatagtgagtcgtattacgtagatccagacatgataagatacattgatga
gtttggacaaaccacaactagaatgcagtgaaaaaaatgc

Full Sequence:

pCS107

Name: pCS107
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Comments: vector size 4.1 kb
Sequencing Primers: t7, sp6
Polylinker Sequence:
cgccattctgcctggggacgtcggagcaagcttgatttaggtgacactat
agaatacaagctacttgttctttttgcaggatcccatcgattcgaattcg
tcgacaggccaatctggccgcggccgcaaggcctctcgagcctctgcggc
tatagtgagtcgtattacgtagatccagacatgataagatacattgatga
gtttggacaaaccacaactagaatgcagtgaaaaaaatgc

Full Sequence:

pCS108

Name: pCS108
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: t7, t3, sp6
Polylinker Sequence:
CGCCATTCTGCCTGGGGACGTCGGAGCAAGCTTGATTTAGGTGACACTAT
AGAATACAAGCTACTTGTTCTTTTTGCAGGATCCCATCGATTCGAATTCG
TCGACAGGCCAATCTGGCCGCGGCCGCAAGGCCTGATATCTCTAGACCGC
GGCTCGAGCCTCTCGCCCTATAGTGAGTCGTATTACGTAGATCCAGACAT
GATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA
AAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACC
ATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTAT
GTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAATTCGCGGCGCGCC
GCGGCGCCAATGCATTGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGA
GGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTG
AAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAA
AGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCG

Full Sequence:

pCS111

Name: pCS111
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Vector Map: Available Here
Comments: Mustafa Khokha modified pCS108 by cloning a linker between the EcoRI and NotI sites eliminating the SfiI site and creating a SmaI site. This creates a vector suitable for cloning cDNAs using the methods from the XGC.
Sequencing Primers: t7, t3, sp6
Polylinker Sequence:
TGTGCCAATTCAATATGGCGTATATGGACTCGTGCCAATTCAATATGGTG
GATCTGGACCCCAGCCAATTCAATATGGCTATTGGCCAGGTTCAATACTA
TGTATTGGCCCTATGCCATATAGTATTCCATATATGGGTTTTCCTATTGA
CGTAGATAGCCCCTCCCAATGGGCGGTCCCATATACCATATATGGGGCTT
CCTAATACCGCCCATAGCCACTCCCCCATTGACGTCAATGGTCTCTATAT
ATGGTCTTTCCTATTGACGTCATATGGGCGGTCCTATTGACGTATATGGC
GCCTCCCCCATTGACGTCAATTACGGTAAATGGCCCGCCTGGCTCAATGC
CCATTGACGTCAATAGGACCACCCACCATTGACGTCAATGGGATGGCTCA
TTGCCCATTCATATCCGTTCTCACGCCCCCTATTGACGTCAATGACGGTA
AATGGCCCACTTGGCAGTACATCAATATCTATTAATAGTAACTTGGCAAG
TACATTACTATTGGAAGTACGCCAGGGTACATTGGCAGTACTCCCATTGA
CGTCAATGGCGGTAAATGGCCCGCGATGGCTGCCAAGTACATCCCCATTG
ACGTCAATGGGGAGGGGCAATGACGCAAATGGGCGTTCCATTGACGTAAA
TGGGCGGTAGGCGTGCCTAATGGGAGGTCTATATAAGCAATGCTCGTTTA
GGGAACCGCCATTCTGCCTGGGGACGTCGGAGCAAGCTTGATTTAGGTGA
CACTATAGAATACAAGCTACTTGTTCTTTTTGCAGGATCCCATCGATTCG
AATTCGTCCCGGGAATCTGGCCGCGGCCGCAAGGCCTGATATCTCTAGAC
CGCGGCTCGAGCCTCTCGCCCTATAGTGAGTCGTATTACGTAGATCCAGA
CATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGT
GAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTA
ACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTT
TATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAATTCGCGGCGC
GCCGCGGCGCCAATGCATTGGGCCCGGTACCCAGCTTTTGTTCCCTTTAG
TGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGT
GTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGGAGCA
TAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATT
GCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCT
GCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGC
GCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGA
TCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGG


pCS2+

Name: pCS2+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Max Planck Institute/Rupp
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Comments: Expression vector, T7 may be mutated. NOTES: Vector size 4095 bp. pCS2+ is an expression vector primarily designed for expressing proteins in Xenopus embryos from either injected RNA or DNA, pCS2+ is also useful for high-level transient expression in a wide variety of mammalian and avian cells. It is also functional in zebrafish embryos (as DNA or RNA) and it can be used for invitro transcription/translation. pCS2+ contains a strong enhancer/promoter (simian CMV 1E94) followed by a polylinker and the SV40 late polyadenylation site. An sp6 promoter is present in the 5' UTR, allowing in vitro RNA synthesis of sequences cloned into the polylinker. A T7 promoter in reverse orientation between the polylinker and the SV40 polyA site for probe synthesis, as well as a second polylinker after the SV40 polyA site provide several sites to linearize the vector for Sp6 RNA transcription. Vector backbone is pBluescript II KS+ and includes the amp gene and an f1 origin for single stranded DNA.
Sequencing Primers: t7, sp6
Polylinker Sequence:
cgccattctgcctggggacgtcggagcaagcttgatttaggtgacactat
agaatacaagctacttgttctttttgcaggatcccatcgattcgaattca
aggcctctcgagcctctagaactatagtgagtcgtattacgtagatcgag
a

Full Sequence:

pCS22+

Name: pCS22+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Vector Map: Available Here
Polylinker Sequence:
CGCCATTCTGCCTGGGGACGTCGGAGCAAGCTTTAATACGACTCACTATA
GGGCAATACAAGCTACTTGTTTAAACTCTGCAGGGATCCGAATTCCTCGA
GCCCTTTAGTGAGGGTTAATTTACGTAGATCCAGACATGATAAGATACAT
TGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTA
TTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGC
AATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCA
GGGGGAGGTGTGGGAGGTTTTTTAATTCGCGGCCGCGGCGCCAATGCATT
GGGCCCGGTACCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGT
GAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATA
AAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGC
GTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGC
ATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGC
TCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCG
GCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAAT
CAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCC
AGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCC
CCCTGACGAGCATCACAAAA

Full Sequence:

pCS2G

Name: pCS2G
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: RIKEN/Carninci
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Comments: pCS2-based expression vector
Sequencing Primers: t7, sp6
Polylinker Sequence:
aagcttgatttaggtgacactatagaatacaagctacttgttctttttgc
aggatctctcgaatcacaagtttgtacaaaaaagcaggctctcgagctct
aataaggtgacactatagaacca--------5'-cDNA_insert-3'--
----ctctccagtattggatccacccagctttcttgtacaaagtggtgat
gatccgtccgtcgagcctctacattctgcagccctatagtgagtcgtatt
acgtaga

Full Sequence:

pDeliver1.1

Name: pDeliver1.1
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Genecopeia
Vector type: Gateway entry vector

pDNR-Dual

Name: pDNR-Dual
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Clontech
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), t7
Polylinker Sequence:
gcggccgcataacttcgtatagcatacattatacgaagttatcagtcgac
ggtaccggacatatgcccgggaattcctgcaggatccgctcgagaagctt
tctagaccattcgtttggcgcgcgggcccaggtgagtggtcataatcata
atcataatcataatcataatcacaactagcctaggagatcctggtcatga
ctagtgcttggattctcaccaataaaaaacgcccggcggcaaccgagcgt
tctgaacaaatccagatggagttctgaggtcattactggatctatc

Full Sequence:

pDNR-LIB

Name: pDNR-LIB
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Clontech
Vector type: plasmid
Vector Map: Available Here
Polylinker Sequence:
gcggccgcataacttcgtatagcatacattatacgaagttatcagtcgac
ggtaccggacatatgcccgggaattcggccattacggcctgcaggatccg
aaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaa
ttgttgttgttaacttgtttattgcagcttataatggttacaaataaagc
aatagcatcacaaatttcacaaataaagcatttttttcactgcattctag
ttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatccggc
cgcctcggccctcgagaagctttctagaccattcgtttggcgcgcgggcc
cagtaggtaagtgaacatggtcatagctgtttccctaggagatcctggta
tgactagtgcttggattctcaccaataaaaaacgcccggcggcaaccgag
cgttctgaacaaatccagatggagttctgaggtcattactggatctatca

Full Sequence:

pDNR-NCI

Name: pDNR-NCI
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Clontech
Vector type: phagemid
Vector Map: Available Here
Comments: Clontech preliminary MGC vector
Polylinker Sequence:
GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTCGAC
GAATTCTGGATCTGGAAACAGCTATGACCATGCTCGGGAAGCGCGCCATT
GTGTTGGTACCCGGGAATTCGGCCATTATGGCCTGCAGGATCCGGTGGTG
GTGCAAATCAAAGAACTGCTCCTCAGTGGATGTTGCCTTTACTTCTAGGC
CTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTGCGGAATTGTACCCGCG
GGCCCACCATGGCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTGCTT
ATGGCCATGGAGGCCCGAATTCGGTCGACCGAGATCTCTCGAGGTACCGC
GGCCGCGGGGATCCGGCCGCCTCGGCCCAGTCGACTCTAGACTCGAGCAA
GCTTATGCATGCGGCCGCAATTCGAGCTCACTTGGCCAATTCGCCCTATA
GTGAGTCGTATTAACTGGCCGTCGTTTTACAGATCCTGGCATGACTAGTG
CTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAA
CAAATCCAGATGGAGTTCTGAGGTCATTACTGGATCTATCAACAGGAGTC
CAAGCGAGCTCGATATCAAATTACGCCCCGCCCTGCCACTCATCGCAGTA
CTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAGACGG
CATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGC

Full Sequence:

pDONR201

Name: pDONR201
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Polylinker Sequence:
cctactctcgcgttaacgctagcatggatctcgggccccaaataatgatt
ttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatg
cttttttataatgccaagtttgtacaaaaaagcaggctnn....cDNA
insert...nacccagctttcttgtacaaagtgggcattataagaaagca
ttgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaa
tcattatttgccatccagctgcagctctggcccgtgtctcaaaatctctg
atgttacattgcacaagataaaaatatatcatcatgaacaataaaactgt
ctgcttaca

Full Sequence:

pDONR223

Name: pDONR223
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Dana Farber Cancer Institute/Vidal Lab
Vector type: plasmid
Vector Map: Available Here
Polylinker Sequence:
AACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGAC
TGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATA
ATGCCAACTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAA
TATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACT
GTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGATGGTATT
AGTGACCTGTA-insert-CCCTATAGTGAGTCGTATTACATGGTCATAG
CTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTG

Full Sequence:

pENTR/D-TOPO

Name: pENTR/D-TOPO
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7
Polylinker Sequence:
TAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCC
AGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGAC
CTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTT
TGTACAAAAAAGCAGGCTCCGCGGCCGCCCCCTTCACC-ORF-AAGGGTG
GGCGCGCCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCAT
TGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAAT
CATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGG
TCATAGCTGTTTCCTGGCAGCTCTG

Full Sequence:

pENTR201

Name: pENTR201
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Invitrogen Life Technologies
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: pDONR201-forward, pDONR201-reverse
Polylinker Sequence:
ACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACC
GCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATG
GCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCG
CCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGAT
TTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAG
GCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCC
CTACTCTCGCGTTAACGCTAGCATGGATCTCGGGCCCCAAATAATGATTT
TATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGC
TTTTTTATAATGCCAACTTTGTACAAAAAAGCTGGCACCATG-linker-
ORF-linker-GGCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGA
AAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAA
TAAAATCATTATTTGCCATCCAGCTGCAGCTCTGGCCCGTGTCTCAAAAT
CTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAA
ACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTC
AACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTA
TATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAAT
CTATCGCTTGTATGGGAAGCCCGATGCGC

Full Sequence:

pENTR221

Name: pENTR221
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Invitrogen Life Technologies
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:
CGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTC
GTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATG
GATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCG
GGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAA
CAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGC
AGGCT-linker-ORF-linker-ACCCAGCTTTCTTGTACAAAGTTGGC
ATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTAT
CAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTG
AGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCT
CAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAAC
AATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCC
ATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCA

Full Sequence:

pENTR223

Name: pENTR223
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Dana Farber Cancer Institute/Vidal Lab
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: M13(-21), t7
Polylinker Sequence:
CAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTAT
TTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTT
TCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCA
AATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTG
ATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTG-link
er-ORF-linker-CCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAG
CATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAA
AATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACA
TGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGA
TGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAG
CCAGGACAGAAATGCCTCGACTTCGCTGC

Full Sequence:

pENTR223.1

Name: pENTR223.1
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Invitrogen Life Technologies
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: M13(-21), t7
Polylinker Sequence:
GCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTC
TTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGT
TCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTA
CAAAAAAGCAGAAG-linker-ORF-linker-GCCCAGCTTTCTTGTAC
AAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACA
GGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCC
CCTATAGTGAGTCGTATTACATGGTCAT

Full Sequence:

pENTR223.1-LC

Name: pENTR223.1-LC
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Blue Heron
Vector type: Gateway entry vector
Comments: The pENTR223.1-LC vector has the pBR ORI. Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pENTR223.1-LC.doc ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13F
Polylinker Sequence:
GTACAAAAAAGCAGAAG- ggccgtcaaggcccacc(linker)-ORF-
ggcctcatgg(linker)-GCCCAGCTTTCTTGTAC

Full Sequence:

pENTR223.1-Sfi

Name: pENTR223.1-Sfi
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Comments: same as pENTR223.1; Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pENTR223.1-Sfi-map.doc ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13F, T7 Rev
Polylinker Sequence:
GAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAAC
GCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTC
TTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGT
TCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTA
CAAAAAAGCAGAAGGGCCGTCAAGGCCCTGCAGACTGGCTGTGTATAAGG
GAGCCTGACATTTATATTCCCCAGAACATCAGGTTAATGGCGTTTTTGAT
GTCATTTTCGCGGTGGCTGAGATCAGCCACTTCTTCCCCGATAACGGAGA
CCGGCACACTGGCCATATCGGTGGTCATCATGCGCCAGCTTTCATCCCCG
ATATGCACCACCGGGTAAAGTTCACGGGAGACTTTATCTGACAGCAGACG
TGCACTGGCCAGGGGGATCACCATCCGTCGCCCGGGCGTGTCAATAATAT
CACTCTGTACATCCACAAACAGACGATAACGGCTCTCTCTTTTATAGGTG
TAAACCTTAAACTGCATTTCACCAGTCCCTGTTCTCGTCAGCAAAAGAGC
CGTTCATTTCAATAAACCGGGCGACCTCAGCCATCCCTTCCTGATTTTCC
GCTTTCCAGCGTTCGGCACGCAGACGACGGGCTTCATTCTGCATGGTTGT
GCTTACCAGACCGGAGATATTGACATCATATATGCCTTGAGCAACTGATA
GCTGTCGCTGTCAACTGTCACTGTAATACGCTGCTTCATAGCACACCTCT
TTTTGACATACTTCGGGTATACATATCAGTATATATTCTTATACCGCAAA
AATCAGCGCGCAAATACGCATACTGTTATCTGGCTTTTAGTAAGCCGGAT
CCACGCGATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTC
ATTAAGCATTCTGCCGACATGGAAGCCATCACAGACGGCATGATGAACCT
GAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCC
ATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATC
AAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCT
CAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACA
TCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACT
CCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAG
GGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGG
AATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGG
ATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATAT
CCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCC
TCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCC
AGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATA
ACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTG
GAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCA
GGGCTTCCCGGTATCAACAGGGACAGGCCTCATGGGCCCAGCTTTCTTGT
ACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAA
CAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATAT
CCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCT
GGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATA

Full Sequence:

pET-28a

Name: pET-28a
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Novagen
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: pET Upstream Primer, T7 Terminator Primer

pET-28b

Name: pET-28b
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Novagen
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: pET Upstream Primer, T7 Terminator Primer

pExpress-1

Name: pExpress-1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Express Genomics/Gruber
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gcagttttcccagtcacgacgttgtaaaacgacggccagtgcctagctta
taatacgactcactatagggaccactcctcgaggttaattaagcggccgc
cc...cDNA
insert...atccgggaattccggaccgaaacttgttctatagtgtcacc
taaataggcctaatggtcatagctgtttcctgtgtgaaattgttatccgc
t

Full Sequence:

pFLC1

Name: pFLC1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: RIKEN/Carninci
Vector type: phagemid
Comments: this vector is identical to pBluescriptR used by Mike Brownstein

pGA1

Name: pGA1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pGA1-MCS.pdf ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pGA14

Name: pGA14
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pGA14-MCS.pdf ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pGA15

Name: pGA15
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pGA15-MCS.pdf ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pGA18

Name: pGA18
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pGA18-MCS.pdf ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pGA19

Name: pGA19
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pGA19-MCS.pdf ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pGA24

Name: pGA24
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pGA24-MCS.pdf ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pGA4

Name: pGA4
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pGA4-MCS.pdf ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pGA7

Name: pGA7
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pGA7-MCS.pdf ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pGH

Name: pGH
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: phagemid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pGH.doc ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pMA

Name: pMA
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pMA.doc ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:
ggccgtcaaggcctaggcgcgccatgagctctaaagcttcgctcgagctg
cggccgcacggatcctcgaattcccaagcttatctcgagtagcggccgct
tggatcccagaattctaggtacctcttaattaactggcctcatgggcc

Full Sequence:

pME18S-FL3

Name: pME18S-FL3
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: University of Tokyo/Sugano lab
Vector type: phagemid
Has Custom Primer: yes
Vector Map: Available Here
Comments: DraIII sites are lost in cDNA cloning and the XhoI sites should be used to isolate the cDNA insert.
Polylinker Sequence:
tgtacggaagtgttacttctgctctaaaagctgcggaattcctcgagcac
tgtgtgatatccattgtgctggcgcggattctttatcactgataagttgg
tggacatattatgtttatcagtgataaagtgtcaagcatgacaaagttgc
agccgaatacagtgatccgtgccgccctagacctgttgaacgaggtcggc
gtagacggtctgacgacacgcaaactggcggaacggttgggggttcagca
gccggcgctttactggcacttcaggaacaagcgggcgctgctcgacgcac
tggccgaagccatgctggcggagaatcatagcacttcggtgccgagagcc
gacgacgactggcgctcatttctgactgggaatgcccgcagcttcaggca
ggcgctgctcgcctaccgccagcacaatggcaccatgtgctcgagctgca
ggtcgcggccgctaga

Full Sequence:

pMK

Name: pMK
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pMK.doc ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:
ggccgtcaaggcctaggcgcgccatgagctctaaagcttcgctcgagctg
cggccgcacggatcctcgaattcccaagcttatctcgagtagcggccgct
tggatcccagaattctaggtacctcttaattaactggcctcatgggcc

Full Sequence:

pMK-U

Name: pMK-U
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: http://image.hudsonalpha.org/html/libs/pMK-U.doc ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:
ggccgtcaaggcccctcagcagacatnnnactttcgctgaggggcctcat
gggcc

Full Sequence:

pOTB7

Name: pOTB7
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: UCBerkeley/Rubin
Vector type: plasmid
Vector Map: Available Here
Comments: this vector contains the Gateway recombination cassette in the polylinker.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
cgttagaacgcggctacaattaatacataaccttatgtatcatacacata
cgatttaggtgacactatagaactcgaaggatccacaagtttgtacaaaa
aagcaggcttgtaaaacgacggccagtaactataacggtcctaaggtagc
gaggcctgggtggcgaattcccttactagtttccctcgaggcatctatgt
cgggtgcggagaaagaggtaatgaaatggcacatggtcatagctgtttcc
tgacccagctttcttgtacaaagtggtagatctgccggtctccctatagt
gagtcgtattaatttcgataagccaggttaacctgcattaatgaatcggc
tgcagtacccgggaatttaacccgcctaatgagcgggctttt

Full Sequence:

pOTB7-3

Name: pOTB7-3
Antibiotic: chloramphenicol
Concentration: 10ug/ml
Source: University of Michigan, Ann Arbor
Vector type: phagemid
Comments: Custom vector from pOTB7 parent, the POTB7 vector was modified to produce pOTB7-3 by inserting an F1 origin in the SmaI site at 358 of pOTB7, an AscI restriction site in the BglII site at 278, and the bacterial CCD killer gene flanked by BstXI restriction sites in the XhoI site at 185 (note the M13 reverse primer is lost during cloning).
Sequencing Primers: M13(-21), t7, sp6
Polylinker Sequence:
cgttagaacgcggctacaattaatacataaccttatgtatcatacacata
cgatttaggtgacactatagaactcgaaggatccacaagtttgtacaaaa
aagcaggcttgtaaaacgacggccagtaactataacggtcctaaggtagc
gaggcctgggtggcgaattcccttactagtttccctcgagcggccgccag
tgtgctggaaagcatgttctttcctgcgttatcccctgattctgtggata
accgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacg
accgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacg
caaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacg
acaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtg
agttagctcactcattaggcaccccaggctttacactttatgcttccggc
tcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaaca
gctatgaccatgattacgccaagctatttaggtgacactatagaatactc
aagctatgcatcaagcttggtaccgagctcggatccactagtaacggccg
ccagtgtgctggaattctgcagatatccatcacactggcggccgctcgag
gcatctatgtcgggtgcggagaaagaggtaatgaaatggcacatggtcat
agctgtttcctgacccagctttcttgtacaaagt

Full Sequence:

pOTB7a

Name: pOTB7a
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Edge Biosystems
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), t7, sp6
Polylinker Sequence:
cgttagaacgcggctacaattaatacataaccttatgtatcatacacata
cgatttaggtgacactatagaactcgaaggatccacaagtttgtacaaaa
aagcaggcttgtaaaacgacggccagtaactataacggtcctaaggtagc
gaggcctgggtggcctcgagccttccgaattctttcattacctctttctc
cgcaccccacataaagtgcggagaaagaggtaatgaaatggcacccagct
ttcttgtacaagtggtagatctgccggtctccctatagtgagtcgtatta
atttcgataagccaggttaacctgcattaatgaatcggctgcagtacccg
ggaatttaacccgcctaatgagc

Full Sequence:

pPCR-Script Amp SK(+)

Name: pPCR-Script Amp SK(+)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
ttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcg
aattgggtaccgggccccccctcgaggtcgacggtatcgataagcttgat
atcgaattcctgcagcccgggggatccgcccgggctagagcggccgccac
cgcggtggagctccagcttttgttccctttagtgagggttaattgcgcgc
ttggcgtaatcatggtcatagctgtttcc

Full Sequence:

pRKW2

Name: pRKW2
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: DKFZ/Niehrs
Vector type: phagemid
Has Custom Primer: yes
Vector Map: Available Here
Comments: modified from pRK5
Sequencing Primers: M13(-21), M13 reverse, AG195, AG189
Polylinker Sequence:
catacgatttaggtgacactatagaataacatccactttgcctttctctc
cacaggtgtccactcccaggtccaactgcacctcggttctatccgggccc
gaatacaagctacttgttctttttgcactcgag...5'-insert-3'..
.ggatccactagttctagagcggccgccaccgcggtggagcttggccgtg
gcccaacttgtttattgcagcttataatggttacaaataaagcaatagca
tcacaaatttcacaaataaag

Full Sequence:

pSMART_cDNA

Name: pSMART_cDNA
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Lucigen Corporation
Vector type: plasmid
Comments: pSMART_cDNA -- A derivative of Lucigen's pSMART vector, containing a pUC19 multiple cloning site. Vector map previously located here: http://www.lucigen.com/catalog/index.php?cPath=14_15_18
Sequencing Primers: pSMART-1777F, pSMART-200R
Polylinker Sequence:
ttcggcgcgcctaaacacataatcagccgagtctttgcaatagtagaaat
tcatcactttctagatcctgaaccctatggacaccttcatcttcctccac
tcgtaatctccttgatactagattctctctatagcaggattcttcgcaca
accagattctcagaaaaaccggtcagagaaaagctaaaccaaacaagtca
aagcacaggaacgaacacatccaagaaacaagtgagaagcaacagttgtt
cagcaaaggtttggtgcggctacaatatttcgagctgattacagataaga
ccaccgagcttatgtgcaacagggtgccctattgtctaaataactaatac
tccccgagtctgaaccgctcgatcgaacctcactcaacactgacgagagc
gagtcgtctaactcttgcagcctctttgcgtcgtgaaagctctctggatc
ctctagagtcgacctgcaggcatgcaagctt

Full Sequence:

pSPORT1

Name: pSPORT1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gaagagctatgacgtcgcatgcacgcgtacgtaagcttggatcctctaga
gcggccgc{3' - cDNA insert -
5'}gtcgacccgggaattccggaccggtacctgcaggcgtaccagctt

Full Sequence:

pSPORT2

Name: pSPORT2
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
cattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggc
ctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgat
taagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacg
gccagtgaattgaatttaggtgacactatagaagagctatgacgtcgcat
gcacgcgtacgtaagcttggatcctctagagtcgacgagctcactagtga
cagcggccgccccgggaattccggaccggtacctgcaggcgtaccagctt
tccctatagtgagtcgtattagagcttggcgtaatcatggtcatagctgt
ttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagcc
ggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcac
attaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgt

Full Sequence:

pT7T3D-PacI

Name: pT7T3D-PacI
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Columbia University/Soares
Vector type: plasmid
Vector Map: Available Here
Comments: Modified by Soares from original Pharmacia pT7T3 vector. NOTE: Washington University's trace files indicate that the "c" at 40 bp (directly before the EcoRI site) should be deleted. NOTE: Please do not contact Pharmacia with questions about this vector; it is a modified version of their original pT7T3 vector (which itself is not offered any more by Pharmacia) which they have never carried as a catalog item. If you have questions, please contact help@image.llnl.gov. Also please note that especially in the past, this vector has been known by several aliases, including pT7T3D-Pac and pT7T3D.
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
tttaatacgactcactatagggaatttggccctcgaggccaagaattccc
gactacgtagtcggggatccgtcttaattaagcggccgcaagcttattcc
ctttagtgagggttaattttagcttggcactggccgtcgttttacaacgt
cgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcaca
tccccctttcgccagctggcgtaatagcgaagag

Full Sequence:

pUC19

Name: pUC19
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: New England Biolabs
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:
gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaat
gcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaac
gcaattaatgtgagttagctcactcattaggcaccccaggctttacactt
tatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttc
acacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcag
gtcgactctagaggatccccgggtaccgagctcgaattcactggccgtcg
ttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgc

Full Sequence:

pUC19-Cam

Name: pUC19-Cam
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Takara Bio Inc.
Vector type: plasmid
Comments: Vector map previously at: http://catalog.takara-bio.co.jp/en/product/basic_info.asp?catcd=B1000503&subcatcd=B1000509&unitid=U100005395
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:
gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaat
gcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaac
gcaattaatgtgagttagctcactcattaggcaccccaggctttacactt
tatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttc
acacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcag
gtcgactctagaggatccccgggtaccgagctcgaattcactggccgtcg
ttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgc

Full Sequence:

pUC19-Kan

Name: pUC19-Kan
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: New England Biolabs
Vector type: plasmid
Comments: Vecor map previously at: http://catalog.takara-bio.co.jp/en/PDFFiles/3299_DS_e.pdf
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:
gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaat
gcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaac
gcaattaatgtgagttagctcactcattaggcaccccaggctttacactt
tatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttc
acacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcag
gtcgactctagaggatccccgggtaccgagctcgaattcactggccgtcg
ttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgc

Full Sequence:

pUC19-Sfi

Name: pUC19-Sfi
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Codon Devices
Vector type: plasmid
Comments: pUC19-Sfi -- A pUC19 derivative with the multiple cloning site swapped with a SfiI linker. Vector map previously located at: http://catalog.takara-bio.co.jp/en/product/basic_info.asp?catcd=B1000503&subcatcd=B1000509&unitid=U100005395
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:
gaattcggccacattggccatctcactggcacagctccacctggcccggc
ctcttttggacggccttcgaggccggatcctctagagtcgacctgcaggc
atgcaagctt

Full Sequence:

pUC57

Name: pUC57
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Genscript
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:

pYX-Asc

Name: pYX-Asc
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Columbia University/Soares
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Sequencing Primers: t7, t3, custom
Polylinker Sequence:
attaattaaccctcactaaagggacctaactataacggtcctaaggtagc
gagcggccgcggccagggaggccgatatcgaattcggcgcgccgtcgact
ttcattacctctttctccgcaccccacataaatctccctatagtgagtcg
tattaacatg

Full Sequence:

pZERO-2

Name: pZERO-2
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
ggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaa
acagctatgaccatgattacgccaagctatttaggtgacactatagaata
ctcaagctatgcatcaagcttggtaccgagctcggatccactagtaacgg
ccgccagtgtgctggaattctgcagatatccatcacactggcggccgctc
gagcatgcatctagagggcccaattcgccctatagtgagtcgtattacaa
ttcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgtta
cccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaat
agcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctata

Full Sequence:

pZL-1

Name: pZL-1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: pSPORT plus a single LoxP site
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gccagtgaattgaatttaggtgacactatagaagagctatgacgtcgcat
gcacgcgtacgtaagcttggatcctctagagcggccgccgactagtgagc
tcgtcgacccgggaattccggaccggtacctgcaggcgtaccagctttcc

Full Sequence:
horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu